Ric; very slightly slow and loopy movement. Aberrant EPG.

Ric; very slightly slow and loopy movement. Aberrant EPG.

Ric; very slightly slow and loopy movement. Aberrant EPG.

Previously called MA1132.

jsIs682 [rab-3p::GFP::rab-3 + lin-15(+)] III. rep-1(ok3296) homozygotes arrest as uncoordinated non-pumping starved L2/L3 animals with GFP::RAB-3 mislocalized to neuronal cell bodies. Presence of jsIs682 makes definitive identification of ok3296 homozygotes much easier. sC1(s2023) dpy-1 homozygotes are viable dpy animals. Heterozygotes are wild-type. Pick wild-type and check for correct segregation of progeny to maintain. ok3296 deletes 556 bp including the first 54 bp of exon 6 and has the sequence junction AGCTGAAACCGGTGCTACAG/CCATTCCTCTTCCCACTCTA. This strain replaces RB2411, which was an unbalanced heterozygous strain; also see NM4337. Reference: Dour S and Nonet ML. In preparation.

juSi94 [GFP11::rps-18 + Cbr-unc-119(+)] II. juEx5515 [unc-25p::GFP1-10 + unc-25p::mCherry::rab-3 + ttx-3p::RFP]. Pick ttx-3::RFP to maintain. GABAergic motor neuron-specific expression of split GFP reporter allows visualization of ribosomes in neurons, and GABAergic motor neuron-specific expression of mCherry::rab-3. Reference: Noma et al Elife. 2017 Aug 2;6. pii: e26376. doi: 10.7554/eLife.26376.

otIs355 [rab-3::NLS::tagRFP]. otIs45 [unc-119::GFP] V. Pan-neural expression with no injection marker. Reference: Nguyen JP, et al. Proc Natl Acad Sci U S A. 2016 Feb 23;113(8):E1074-81.

acEx189 [rab-3p::unc-30 + myo-2::mCherry]. Pick mCherry+ animals to maintain. Expression of unc-30 driven by rab-3 neuronal promoter rescues unc-30(ok613) in neurons. Reference: Otarigho B & Aballay A. Cell Rep. 2021 May 25;35(8):109187. doi: 10.1016/j.celrep.2021.109187. PMID: 34038721.

kqEx73 [pat-3(sp) + rab-3::RFP + cki-1::GFP]. Pick RFP+ to maintain. kqEx73 carries a form of pat-3 gene with splicing defects; rescues pat-3 null allele. pat-3(sp) is a frameshift mutation in the splice acceptor region (ag to aa) that abolishes conserved interaction domains such as the NPxY motifs and creates a splice variant with an extra 19 amino acids. The pat-3(sp) animals not only produce mutant pat-3, but also express the regular splice form due to utilization of an unusual splice acceptor. Abnormal Distal Tip Cell migration and pat-3 gene splicing (intron 7) defects. Reference: Kihira S, et al. PLoS One. 2012;7(8):e42425.

Engineered null mutations in predicted GPCR genes. Reference: Pu L, et al. Nat Commun. 2023 Dec 18;14(1):8410. PMID: 38110404.

wyIs45 [ttx-3p::GFP::rab-3 + unc-122p::RFP] X. olaEx603 [rab-3p::cima-1 + unc-122p::GFP]. Maintain by picking animals with GFP expression in coelomocytes. olaEx605 does not rescue AIY presynaptic defects in cima-1(wy84) mutants. Reference: Shao Z, et al. Cell. 2013 Jul 18;154(2):337-50.

wyIs45 [ttx-3p::GFP::rab-3 + unc-122p::RFP] X. olaEx609 [aex-3p::cima-1 + unc-122p::GFP]. Maintain by picking animals with GFP expression in coelomocytes. olaEx609 does not rescue AIY presynaptic defects in cima-1(wy84) mutants. Reference: Shao Z, et al. Cell. 2013 Jul 18;154(2):337-50.

wyIs45 [ttx-3p::GFP::rab-3 + unc-122p::RFP] X. olaEx551 [cima-1p::cima-1 + unc-122p::GFP]. Maintain by picking animals with GFP expression in coelomocytes. olaEx551 rescues AIY presynaptic defects in cima-1(wy84) mutants. Reference: Shao Z, et al. Cell. 2013 Jul 18;154(2):337-50.

wyIs45 [ttx-3p::GFP::rab-3 + unc-122p::RFP] X. olaEx644 [ttx-3p::cima-1 + unc-122p::GFP]. Maintain by picking animals with GFP expression in coelomocytes. olaEx642 does not rescue AIY presynaptic defects in cima-1(wy84) mutants. Reference: Shao Z, et al. Cell. 2013 Jul 18;154(2):337-50.

wyIs45 [ttx-3p::GFP::rab-3 + unc-122p::RFP] X. olaEx647 [hlh-17p::cima-1 + unc-122p::GFP]. Maintain by picking animals with GFP expression in coelomocytes. olaEx647 does not rescue AIY presynaptic defects in cima-1(wy84) mutants. Reference: Shao Z, et al. Cell. 2013 Jul 18;154(2):337-50.

wyIs45 [ttx-3p::GFP::rab-3 + unc-122p::RFP] X. olaEx765 [dpy-7p::cima-1 + unc-122p::GFP]. Maintain by picking animals with GFP expression in coelomocytes. olaEx765 rescues AIY presynaptic defects in cima-1(wy84) mutants. Reference: Shao Z, et al. Cell. 2013 Jul 18;154(2):337-50.

wyIs45 [ttx-3p::GFP::rab-3 + unc-122p::RFP] X. olaEx775 [dpy-4p::cima-1 + unc-122p::GFP]. Maintain by picking animals with GFP expression in coelomocytes. olaEx605 rescues AIY presynaptic defects in cima-1(wy84) mutants. Reference: Shao Z, et al. Cell. 2013 Jul 18;154(2):337-50.

nsIs105 [hlh-17p::GFP] I. wyIs45 [ttx-3p::GFP::rab-3 + unc-122p::RFP] X. olaEx805 [hlh-17p::caspase12 + hlh-17p::caspase17 + ttx-3p::mCherry + glr-3p::mCherry + unc-122p::GFP]. Maintain by picking animals with GFP expression in coelomocytes. Ablation of CEPsh glia partially suppresses AIY presynaptic maintenance defects in cima-1(wy84) mutants. nsIs105 (hlh-17::GFP) expression labels CEPsh glia. Reference: Shao Z, et al. Cell. 2013 Jul 18;154(2):337-50.

olaEx987 [ttx-3p::mCherry::rab-3 + hlh-17p::CD4::GFP1-10 + ttx-3p::CD4::GFP11 + unc-122p::GFP]. Maintain by picking animals with GFP expression in coelomocytes. olaEx987 labels AIY presynaptic sites with mCherry, and AIY and CEPsh contact with GFP. oleEx987 contains GRASP (GFP Reconstitution Across Synaptic Partners) constructs using two GFP fragments, GFP1-10 and GFP11, that can reconstitute a functional GFP molecule only when they are in close proximity. Reference: Shao Z, et al. Cell. 2013 Jul 18;154(2):337-50.

wyIs45 [ttx-3p::GFP::rab-3 + unc-122p::RFP] X. olaEx1004 [F25B3.3p::egl-15(5A) + unc-122p::GFP]. Maintain by picking animals with GFP expression in coelomocytes. olaEx1004 does not rescue egl-15(n484) suppression of cima-1 AIY presynaptic defects. Reference: Shao Z, et al. Cell. 2013 Jul 18;154(2):337-50.

wyIs45 [ttx-3p::GFP::rab-3 + unc-122p::RFP] X. olaEx1015 [dpy-7p::egl-15(5A) + unc-122p::GFP]. Maintain by picking animals with GFP expression in coelomocytes. olaEx1015 rescues egl-15(n484) suppression of cima-1 AIY presynaptic defects. Reference: Shao Z, et al. Cell. 2013 Jul 18;154(2):337-50.

wyIs45 [ttx-3p::GFP::rab-3 + unc-122p::RFP] X. olaEx1054 [dpy-7p::egl-15(5A)(ecto) + unc-122p::GFP]. Maintain by picking animals with GFP expression in coelomocytes. olaEx1054 rescues egl-15(n484) suppression of cima-1 AIY presynaptic defects. Reference: Shao Z, et al. Cell. 2013 Jul 18;154(2):337-50.

olaEx1316 [ttx-3p::CD4::GFP11 + glr-3p::CD4::GFP1-10 + ttx-3p::mCherry::rab-3 + unc-122p::GFP]. Maintain by picking animals with GFP expression in coelomocytes. olaEx1316 labels AIY presynaptic sites with mCherry, and AIY and RIA contact with GFP. oleEx1316 contains GRASP (GFP Reconstitution Across Synaptic Partners) constructs using two GFP fragments, GFP1-10 and GFP11, that can reconstitute a functional GFP molecule only when they are in close proximity. Reference: Shao Z, et al. Cell. 2013 Jul 18;154(2):337-50.

wyIs45 [ttx-3p::GFP::rab-3 + unc-122p::RFP] X. olaEx1411 [dpy-7p::egl-15(5A)::HA + unc-122p::GFP]. Maintain by picking animals with GFP expression in coelomocytes. Reference: Shao Z, et al. Cell. 2013 Jul 18;154(2):337-50.

Diffuse distribution of synaptic vesicle markers (SNB-1, CAT-1, and RAB-3) under hypoxic conditions. pfk-1.1(ola72) causes C562Y missense mutation. Reference: Jang et al. Neuron. 2016 Apr 20;90(2):278-91.

wyIs45 [ttx-3p::GFP::rab-3 + unc-122p::RFP] X. AIY presynaptic maintenance defect at adult stage (synapses appears in asynaptic Zone 3 region). Reference: Shao Z, et al. Cell. 2013 Jul 18;154(2):337-50.

wyIs45 [ttx-3p::GFP::rab-3 + unc-122p::RFP] X. olaEx559 [rol-6p::cima-1 + unc-122p::GFP]. Maintain by picking animals with GFP expression in coelomocytes. olaEx559 rescues AIY presynaptic defects in cima-1(wy84) mutants. Reference: Shao Z, et al. Cell. 2013 Jul 18;154(2):337-50.

fphIs3 [rab-3p::aak-2A::GFP + unc-119(+)]. aak-2A isoform expressed from the neuronal rab-3 promoter in aak-2(ok524) background. Reference: Jeong JH, et al. Nat Commun. 2023 Jan 18;14(1):288. doi: 10.1038/s41467-023-35952-z. PMID: 36653384.

otIs339 [ceh-43(+)(fosmid)::GFP + ttx-3::DsRed + rol-6(su1006)]. otIs355 [rab-3::NLS::tagRFP]. Rollers.

otIs339 [ceh-43(+)(fosmid)::GFP + ttx-3::DsRed + rol-6(su1006)]. otIs355 [rab-3::NLS::tagRFP]. norEx42 [ast-1 Cosmid + ttx-3::GFP + dat-1::mCherry]. Rollers. gk463 embryonic lethality is rescued by extrachromosomal array. Pick mCherry+ animals to maintain.

jsIs682 [rab-3p::GFP::rab-3 + lin-15(+)]. Expresses rab-3::GFP in most, if not all, neurons. rab-3::GFP is localized primarily to synaptic regions.

otIs287 [rab-3::NLS::YFP + rol-6(su1006)]. norEx41 [ceh-43 fosmid + dat-1::mCherry]. Rollers. tm480 embryonic lethality is rescued by extrachromosomal array. Pick mCherry+ animals to maintain.

ntIs1 [gcy-5p::GFP + lin-15(+)] V. otIs305 [hsp-16.2p::che-1::3xHA::BLRP + rol-6(su1006)] V. otIs355 [rab-3::tagRFP] V. Maintain at 15-20C. Rollers. Reference: Tursun B, et al. Science. 2011 Jan 21;331(6015):304-8.

otIs437 [unc-3p::rab-3::GFP + ttx-3p::mCherry] V. Reporter contains 558bp upstream of unc-3 start site; marks presynapses of DA/DB class motor neurons innervating muscle and VD motor neurons in dorsal nerve cord. Reference: Kratsios P, et al. Curr Biol. 2015 May 18;25(10):1282-95.

otEx5663 [unc-30p::GFP::rab-3::unc-10 3'UTR + rol-6(su1006)]. Pick Rollers to maintain. Synaptic GFP marker in D-type motor neurons.

otIs476 [glr-4::TagRFP] II. otIs498 [rab-3(fosmid)::SL2::NLS::YFP::H2B + hygR]. Pan-neuronal nuclear YFP expression. Reference: Stefanakis N., Carrera I., Hobert O. Neuron. 2015 Aug 19;87(4):733-50.

otIs597 [ser-7p::eGFP::rab-3 + ttx-3::mCherry]. Presynaptic marker for M4 pharyngeal neuron. Please contact Oliver Hobert prior to publishing work using this strain.

otIs601[ceh-19p::eGFP::rab-3 + ttx-3::mCherry]. Presynaptic marker for MC pharyngeal neurons. Please contact Oliver Hobert prior to publishing work using this strain.

otIs602 [mnm-2p::eGFP::rab-3 + ttx-3::mCherry]. Presynaptic marker for M3 pharyngeal neurons. Please contact Oliver Hobert prior to publishing work using this strain.

otIs637 [bnc-1p::rab-3::GFP + myo-2p::mCherry]. Reporter for presynapse of VA/VB class motor neurons innervating muscle and DD motor neurons in ventral nerve cord. Reference: Kerk SY, et al. Neuron 2017 (in press).

otIs672 [rab-3::NLS::GCaMP6s + arrd-4:NLS:::GCaMP6s]. Bright panneuronal nuclear GCaMP6s expression. Reference: Yemini E, et al. https://www.biorxiv.org/content/10.1101/676312v1

otIs672 [rab-3::NLS::GCaMP6s + arrd-4:NLS:::GCaMP6s]. See description of strain OH15262 for full description of otIs669 NeuroPAL (Neuronal Polychromatic Atlas of Landmarks) transgene (Yemini E, et al. Cell. 2021 Jan 7;184(1):272-288.e11. PMID: 33378642). Bottlenecked 23x for isogenicity. Slow growing. Reference: Yemini E, et al. Cell. 2021 Jan 7;184(1):272-288.e11. PMID: 33378642 Free pre-print available at https://www.biorxiv.org/content/10.1101/676312v2

otEx7231 [srg-8p::rab-3::GFP + srg-8p::mCherry]. Pick animals with mCherry expression to maintain. Presynaptic RAB-3::GFP reporter for ASK neurons with cytoplasmic ASKp::mCherry in the background. Reference: Majeed M, et al. Elife. 2024 Jan 15:12:RP91775. doi: 10.7554/eLife.91775. PMID: 38224479.

otIs672 [rab-3::NLS::GCaMP6s + arrd-4:NLS:::GCaMP6s]. otIs670 provides a healthier alternative to otIs669, performing better in a variety of phenotypic assays. See description of strain OH15263 for full description of otIs670 NeuroPAL (Neuronal Polychromatic Atlas of Landmarks) transgene. Reference: Yemini E, et al. Cell. 2021 Jan 7;184(1):272-288.e11. PMID: 33378642 Free pre-print available at https://www.biorxiv.org/content/10.1101/676312v2

CRISPR-engineered mutation of CUT transcription factor binding site in endogenously-tagged rab-3(syb3072[rab-3::T2A::3xNLS::GFP]). Causes a reduction in rab-3 expression. Reference: Leyva-Diaz E & Hobert O. Current Biol. 2022 Mar 3;S0960-9822(22)00262-7. PMID: 35259341

otIs287 [rab-3(prom1)::2xNLS::YFP + rol-6(su1006)] IV. Rollers. Pan-neuronal YFP expression. Reference: Stefanakis N., Carrera I., Hobert O. Neuron. 2015 Aug 19;87(4):733-50.

otIs291 [rab-3(prom1)::2xNLS::YFP + rol-6(su1006)] V. Rollers. Pan-neuronal YFP expression. Reference: Stefanakis N., Carrera I., Hobert O. Neuron. 2015 Aug 19;87(4):733-50.

T2A::3xNLS::GFP tag inserted at the C-terminus of the endogenous rab-3 locus by CRISPR. Allele generated by SUNY Biotech. Reference: Leyva-Diaz E & Hobert O. Current Biol. 2022 Mar 3;S0960-9822(22)00262-7. PMID: 35259341

syIs334 [rab-3p::NLS::GAL4SK::VP64::let-858 3'UTR + unc-122p::RFP +  pBlueScript].  rab-3 cGAL driver for the whole nervous system.  Reference: Wang H, et al. Nat Methods. 2017 Feb;14(2):145-148.