| OH18501 |
C. elegans |
aex-1(ot1357) I. Show Description
ot1357 is CRISPR-engineered 5,741 bp deletion removing the entire aex-1 coding region, eliminating all spice isoforms. Sequence after edit: ACTTTTAACATTTTTAAAGCATTAGTTTTCCTTATGAATAGTCTATATTTTATCGACTGGCCGACATAAt. Reference: Sural S, et al. Sci Adv. 2025 Sep 26;11(39):eadw1270. doi: 10.1126/sciadv.adw1270. PMID: 40991693.
|
|
| OH18508 |
C. elegans |
daf-16(ot971[daf-16::GFP]) I; ins-1(ot1360) IV. Show Description
ot1360 is CRISPR-engineered 1,339 bp deletion removing the entire ins-1 coding region. Sequence after edit: TTATAGGGCATTTTTCAGTTCCTCACCGCTCTCAAATCAGGTCAATATCGTTGGCAGCTCACCGGACCCT. Reference: Sural S, et al. Sci Adv. 2025 Sep 26;11(39):eadw1270. doi: 10.1126/sciadv.adw1270. PMID: 40991693.
|
|
| OH18594 |
C. briggsae |
Cbr-eat-4(ot1371[Cbr-eat-4::T2A::GFP::H2B]) III. Show Description
T2A::GFP::H2B tag inserted before STOP codon of endogenous Cbr-eat-4 locus using CRISPR/Cas9. Generated in C. briggsae AF16 background. Reference: Toker IA, et al. bioRxiv 2024.11.23.624988; doi: https://doi.org/10.1101/2024.11.23.624988.
|
|
| OH18596 |
C. briggsae |
Cbr-unc-25(ot1373[Cbr-unc-25::T2A::GFP::H2B]) III. Show Description
T2A::GFP::H2B tag inserted before STOP codon of endogenous Cbr-unc-25 locus using CRISPR/Cas9. Generated in C. briggsae AF16 background. Reference: Toker IA, et al. bioRxiv 2024.11.23.624988; doi: https://doi.org/10.1101/2024.11.23.624988.
|
|
| OH18619 |
C. elegans |
lim-6(ot1391[lim-6::GFP]) X. Show Description
C-terminal GFP tag inserted before STOP codon of endogenous lim-6 locus using CRISPR/Cas9. Generated in N2 background. Reference: Toker IA, et al. bioRxiv 2024.11.23.624988; doi: https://doi.org/10.1101/2024.11.23.624988.
|
|
| OH18624 |
C. tropicalis |
Ctr-lim-6(ot1392[Ctr-lim-6::GFP]) X. Show Description
C-terminal GFP tag inserted before STOP codon of endogenous Ctr-lim-6 locus using CRISPR/Cas9. Generated in C. tropicalis NIC203 background. Reference: Toker IA, et al. bioRxiv 2024.11.23.624988; doi: https://doi.org/10.1101/2024.11.23.624988.
|
|
| OH18640 |
C. briggsae |
Cbr-lim-6(ot1393[Cbr-lim-6::GFP]) X. Show Description
C-terminal GFP tag inserted before STOP codon of endogenous Cbr-lim-6 locus using CRISPR/Cas9. Generated in C. briggsae AF16 background. Reference: Toker IA, et al. bioRxiv 2024.11.23.624988; doi: https://doi.org/10.1101/2024.11.23.624988.
|
|
| OH18671 |
C. tropicalis |
Ctr-unc-25(ot1397[Ctr-unc-25::T2A::GFP::H2B]) III. Show Description
T2A::GFP::H2B tag inserted before STOP codon of endogenous Ctr-unc-25 locus using CRISPR/Cas9. Generated in C. tropicalis NIC203 background. Reference: Toker IA, et al. bioRxiv 2024.11.23.624988; doi: https://doi.org/10.1101/2024.11.23.624988.
|
|
| OH18707 |
C. elegans |
otIs904 V. Show Description
otIs904 [ges-1p::ins-1::tagRFP-T::SL2::GFP::his-44::tbb-2 3 UTR + inx-6p18::tagRFP::unc-54 3' UTR] V. Transgene allows monitoring of the secretion of INS-1 neuropeptide from the intestine under different physiological conditions. The multicopy array was inserted at the oxTi553 landing site using the Fluorescent Landmark Interference (FLInt) method. Reference: Sural S, et al. Sci Adv. 2025 Sep 26;11(39):eadw1270. doi: 10.1126/sciadv.adw1270. PMID: 40991693.
|
|
| OH18821 |
C. elegans |
nlp-18(ot1421[nlp-18::SL2::GFP::H2B]) II. Show Description
SL2::GFP::H2B tag inserted after STOP codon of endogenous nlp-18 locus using CRISPR/Cas9. The 15 first nucleotides of the standard SL2 sequence (immediately downstream of nlp-18 STOP) are missing but bright GFP fluorescence is clearly detectable. Generated in N2 background. Reference: Toker IA, et al. bioRxiv 2024.11.23.624988; doi: https://doi.org/10.1101/2024.11.23.624988.
|
|
| OH18826 |
C. tropicalis |
Ctr-nlp-11(ot1422[Ctr-nlp-11::SL2::GFP::H2B]) II. Show Description
SL2::GFP::H2B tag inserted after STOP codon of endogenous Ctr-nlp-11 locus using CRISPR/Cas9. Generated in C. tropicalis NIC203 background. Reference: Toker IA, et al. bioRxiv 2024.11.23.624988; doi: https://doi.org/10.1101/2024.11.23.624988.
|
|
| OH18829 |
C. briggsae |
Cbr-nlp-3(ot1423[Cbr-nlp-3::SL2::GFP::H2B]) X. Show Description
SL2::GFP::H2B tag inserted after STOP codon of endogenous Cbr-nlp-3 locus using CRISPR/Cas9. Generated in C. briggsae AF16 background. Reference: Toker IA, et al. bioRxiv 2024.11.23.624988; doi: https://doi.org/10.1101/2024.11.23.624988.
|
|
| OH18832 |
C. briggsae |
Cbr-nlp-18(ot1424[Cbr-nlp-18::SL2::GFP::H2B]) II. Show Description
SL2::GFP::H2B tag inserted after STOP codon of endogenous Cbr-nlp-18 locus using CRISPR/Cas9. Generated in C. briggsae AF16 background. Reference: Toker IA, et al. bioRxiv 2024.11.23.624988; doi: https://doi.org/10.1101/2024.11.23.624988.
|
|
| OH18835 |
C. elegans |
ins-7(ot1427) IV. Show Description
ot1427 is CRISPR-engineered 1,007 bp deletion removing the entire ins-7 coding region. Sequence after edit: CTTCGAAGGATAACCCCGAAGAAGCTGTTCCAAAACATAATGGTGGCTCTTCTGGATTTTGGGTTCAATT. Reference: Sural S, et al. Sci Adv. 2025 Sep 26;11(39):eadw1270. doi: 10.1126/sciadv.adw1270. PMID: 40991693.
|
|
| OH18853 |
C. tropicalis |
Ctr-ceh-32(ot1430[Ctr-ceh-32::GFP]) V. Show Description
C-terminal GFP tag inserted before STOP codon of endogenous Ctr-ceh-32 locus using CRISPR/Cas9. Generated in C. tropicalis NIC203 background. Reference: Toker IA, et al. bioRxiv 2024.11.23.624988; doi: https://doi.org/10.1101/2024.11.23.624988.
|
|
| OH18854 |
C. briggsae |
Cbr-ceh-32(ot1431[Cbr-ceh-32::GFP]) V. Show Description
C-terminal GFP tag inserted before STOP codon of endogenous Cbr-ceh-32 locus using CRISPR/Cas9. Generated in C. briggsae AF16 background. Reference: Toker IA, et al. bioRxiv 2024.11.23.624988; doi: https://doi.org/10.1101/2024.11.23.624988.
|
|
| OH18892 |
C. briggsae |
Cbr-unc-17(ot1440[Cbr-unc-17::T2A::mScarlet3::H2B]) IV. Show Description
T2A::mScarlet3::H2B tag inserted before STOP codon of endogenous Cbr-unc-17 locus using CRISPR/Cas9. Generated in C. briggsae AF16 background. Reference: Toker IA, et al. bioRxiv 2024.11.23.624988; doi: https://doi.org/10.1101/2024.11.23.624988.
|
|
| OH18895 |
C. elegans |
ins-35(ot1443) V. Show Description
ot1443 is CRISPR-engineered 646 bp deletion of the ins-35 gene removing all the coding sequence except the last 7 aa, which should not be translated due to the absence of an ATG. Sequence after edit: ttctgaaatttttgaaattgtctaattttcCAGCAGACTCAGATGAACTATTCAATTAATAATTTAAGTT. Reference: Sural S, et al. Sci Adv. 2025 Sep 26;11(39):eadw1270. doi: 10.1126/sciadv.adw1270. PMID: 40991693.
|
|
| OH18961 |
C. tropicalis |
Ctr-nlp-3(ot1453[Ctr-nlp-3::SL2::GFP:H2B]) X. Show Description
SL2::GFP::H2B tag inserted after STOP codon of endogenous Ctr-nlp-3 locus using CRISPR/Cas9. Generated in C. tropicalis NIC203 background. Reference: Toker IA, et al. bioRxiv 2024.11.23.624988; doi: https://doi.org/10.1101/2024.11.23.624988.
|
|
| OH19078 |
C. elegans |
daf-16(ot853[daf-16::mNG::AID*]) I; otIs908 V. Show Description
otIs908 [pha-4(prom2)::TIR1(F79G)::mTur2::tbb-2 3'UTR + unc-122p::mCherry::unc-54 3' UTR] V. TIR1(F79G) expression in all 22 enteric neurons (20 pharyngeal neurons, AVL and DVB), RIS and PVT. The multicopy array was inserted at the oxTi553 landing site using the Fluorescent Landmark Interference (FLInt) method. Reference: Sural S, et al. Sci Adv. 2025 Sep 26;11(39):eadw1270. doi: 10.1126/sciadv.adw1270. PMID: 40991693.
|
|
| OH19089 |
C. tropicalis |
Ctr-nlp-18(ot1474[Ctr-nlp-18::SL2::GFP:H2B]) II. Show Description
SL2::GFP::H2B tag inserted after STOP codon of endogenous Ctr-nlp-18 locus using CRISPR/Cas9. Generated in C. tropicalis NIC203 background. Reference: Toker IA, et al. bioRxiv 2024.11.23.624988; doi: https://doi.org/10.1101/2024.11.23.624988.
|
|
| OH19094 |
C. briggsae |
Cbr-lgc-37(ot1475[Cbr-lgc-37::T2A::mScarlet3::H2B]) III. Show Description
T2A::mScarlet3::H2B tag inserted before STOP codon of endogenous Cbr-lgc-37 locus using CRISPR/Cas9. Generated in C. briggsae AF16 background. Reference: Toker IA, et al. bioRxiv 2024.11.23.624988; doi: https://doi.org/10.1101/2024.11.23.624988.
|
|
| OH19118 |
C. elegans |
otIs913 V. Show Description
otIs913 [pha-4(prom2)::daf-2(DN)::eBFP2::tbb-2 3 UTR + unc-122p::mCherry::unc-54 3' UTR] V. daf-2(DN) encodes a dominant negative form of the DAF-2 protein, causing inhibition of the insulin receptor DAF-2. pha-4(prom2) drives expression of daf-2(DN) in all 22 enteric neurons (20 pharyngeal neurons, AVL and DVB), RIS and PVT. The multicopy array was inserted at the oxTi553 landing site using the Fluorescent Landmark Interference (FLInt) method. Reference: Sural S, et al. Sci Adv. 2025 Sep 26;11(39):eadw1270. doi: 10.1126/sciadv.adw1270. PMID: 40991693.
|
|
| OH19123 |
C. tropicalis |
Ctr-lgc-37(ot1487[Ctr-lgc-37::T2A::mScarlet3::H2B]) III. Show Description
T2A::mScarlet3::H2B tag inserted before STOP codon of endogenous Ctr-lgc-37 locus using CRISPR/Cas9. Generated in C. tropicalis NIC203 background. Reference: Toker IA, et al. bioRxiv 2024.11.23.624988; doi: https://doi.org/10.1101/2024.11.23.624988.
|
|
| OH19124 |
C elegans |
pks-1(ot1488[pks-1::SL2::mScarlet-I3::H2B]) X. Show Description
SL2::mScarlet-I3::H2B tag inserted into endogenous pks-1 locus via CRISPR/Cas9 engineering. Reference: Cao WX, et al. (2024). bioRxiv: 2024.2006.2011.598534. https://doi.org/10.1101/2024.06.11.598534.
|
|
| OH19125 |
C elegans |
pks-1(ot1489[pks-1::SL2::GFP::H2B]) X. Show Description
GFP::H2B tag inserted into endogenous pks-1 locus via CRISPR/Cas9 engineering. Reference: Cao WX, et al. (2024). bioRxiv: 2024.2006.2011.598534. https://doi.org/10.1101/2024.06.11.598534.
|
|
| OH19202 |
C. briggsae |
Cbr-eat-4(ot1507[Cbr-eat-4::SL2::mScarlet3::H2B]) III. Show Description
SL2::mScarlet3::H2B tag inserted after STOP codon of endogenous Cbr-eat-4 locus using CRISPR/Cas9. Generated in C. briggsae AF16 background. Reference: Toker IA, et al. bioRxiv 2024.11.23.624988; doi: https://doi.org/10.1101/2024.11.23.624988.
|
|
| OH19211 |
C. tropicalis |
Ctr-eat-4(ot1512[Ctr-eat-4::SL2::mScarlet3::H2B]) III. Show Description
SL2::mScarlet3::H2B tag inserted after STOP codon of endogenous Ctr-eat-4 locus using CRISPR/Cas9. Generated in C. tropicalis NIC203 background. Reference: Toker IA, et al. bioRxiv 2024.11.23.624988; doi: https://doi.org/10.1101/2024.11.23.624988.
|
|
| OH19212 |
C. tropicalis |
Ctr-unc-17(ot1513[Ctr-unc-17::T2A::mScarlet3::H2B]) IV. Show Description
T2A::mScarlet3::H2B tag inserted before STOP codon of endogenous Ctr-unc-17 locus using CRISPR/Cas9. Generated in C. tropicalis NIC203 background. Reference: Toker IA, et al. bioRxiv 2024.11.23.624988; doi: https://doi.org/10.1101/2024.11.23.624988.
|
|
| OH19232 |
C. elegans |
daf-16(ot853[daf-16::mNG::AID*]) I; otSi2 II. Show Description
otSi2 [ges-1p::TIR1(F79G)::mRuby::unc-54 3'UTR + Cbr-unc-119(+) *ieSi61] II. Intestine-specific TIR1 sequence in ieSi61 allele was edited to TIR1(F79G) using CRISPR/Cas9 to make it compatible with AID2. [TCC GTC GAG CTC AAG GGA AAG CCA CAC TTC] edited to [AGT GTC GAA TTG AAG GGA AAG CCA CAC GGA]. This strain can be used to deplete DAF-16 specifically from the intestine with the modified auxin 5-Ph-IAA. Reference: Sural S, et al. Sci Adv. 2025 Sep 26;11(39):eadw1270. doi: 10.1126/sciadv.adw1270. PMID: 40991693.
|
|
| OH19259 |
C. briggsae |
Cbr-unc-25(ot1524[Cbr-unc-25::SL2::mScarlet3::H2B]) III. Show Description
SL2::mScarlet3::H2B tag inserted after STOP codon of endogenous Cbr-unc-25 locus using CRISPR/Cas9. Generated in C. briggsae AF16 background. Reference: Toker IA, et al. bioRxiv 2024.11.23.624988; doi: https://doi.org/10.1101/2024.11.23.624988.
|
|
| OH19278 |
C. elegans |
aex-4(ot1530[aex-4::SL2::gfp::his-44]) X. Show Description
SL2::GFP::HIS-44 tag inserted into the endogenous aex-4 locus. Reference: Sural S, et al. Sci Adv. 2025 Sep 26;11(39):eadw1270. doi: 10.1126/sciadv.adw1270. PMID: 40991693.
|
|
| OH19280 |
C. elegans |
aex-5(ot1532[aex-5::SL2::gfp::his-44]) I. Show Description
SL2::GFP::HIS-44 tag inserted into the endogenous aex-5 locus. Reference: Sural S, et al. Sci Adv. 2025 Sep 26;11(39):eadw1270. doi: 10.1126/sciadv.adw1270. PMID: 40991693.
|
|
| OH19299 |
C elegans |
unc-75(ot1539[mScarlet-I3::unc-75]) I. Show Description
mScarlet-I3 tag inserted into endogenous unc-75 locus via CRISPR/Cas9 engineering. Reference: Cao WX, et al. (2024). bioRxiv: 2024.2006.2011.598534. https://doi.org/10.1101/2024.06.11.598534.
|
|
| OH19333 |
C. elegans |
aex-1(ot1543[aex-1::SL2::gfp::his-44]) I. Show Description
SL2::GFP::HIS-44 tag inserted into the endogenous aex-1 locus. Reference: Sural S, et al. Sci Adv. 2025 Sep 26;11(39):eadw1270. doi: 10.1126/sciadv.adw1270. PMID: 40991693.
|
|
| OH19337 |
C. elegans |
tph-1(ot1545) II. Show Description
ot1545 is CRISPR-engineered 2,838 bp deletion removing the entire tph-1 coding region. Sequence after edit: tgtatattacgtgccgaattccagaagcaccacgcccaacacaaagacacgttttcctgcagaagaggaa. Reference: Sural S, et al. Sci Adv. 2025 Sep 26;11(39):eadw1270. doi: 10.1126/sciadv.adw1270. PMID: 40991693.
|
|
| OH19575 |
C. elegans |
otIs927 V. Show Description
otIs927 [ges-1p::nlp-40::tagRFP-T::SL2::GFP::his-44::tbb-2 3 UTR + inx-6(prom18)::tagRFP-T::unc-54 3' UTR] V. Transgene allows monitoring of the secretion of NLP-40 neuropeptide from the intestine under different physiological conditions. The multicopy array was inserted at the oxTi553 landing site using the Fluorescent Landmark Interference (FLInt) method. Reference: Sural S, et al. Sci Adv. 2025 Sep 26;11(39):eadw1270. doi: 10.1126/sciadv.adw1270. PMID: 40991693.
|
|
| OH19735 |
C. elegans |
otIs937 V. Show Description
otIs937 [ceh-19(prom2)::daf-2(DN)::eBFP2::SL2::tagRFP-T::tbb-2 3' UTR + unc-122p::GFP::unc-54 3' UTR] V. daf-2(DN) encodes a dominant negative form of the DAF-2 protein, causing inhibition of the insulin receptor DAF-2. daf-2(DN) encodes a dominant negative form of the DAF-2 protein, causing inhibition of the insulin receptor DAF-2. ceh-19(prom2) drives expression of daf-2(DN) specifically in the MC neurons in the pharyngeal nervous system. The multicopy array was inserted at the oxTi553 landing site using the Fluorescent Landmark Interference (FLInt) method. Reference: Sural S, et al. Sci Adv. 2025 Sep 26;11(39):eadw1270. doi: 10.1126/sciadv.adw1270. PMID: 40991693.
|
|
| OH19767 |
C. elegans |
otIs942 V. Show Description
otIs942 [tph-1(prom5)::daf-2(DN)::eBFP2::SL2::tagRFP-T::tbb-2 3' UTR + unc-122p::GFP::unc-54 3' UTR] V. daf-2(DN) encodes a dominant negative form of the DAF-2 protein, causing inhibition of the insulin receptor DAF-2. daf-2(DN) encodes a dominant negative form of the DAF-2 protein, causing inhibition of the insulin receptor DAF-2. tph-1(prom5) drives expression of daf-2(DN) specifically in the NSM neurons. The multicopy array was inserted at the oxTi553 landing site using the Fluorescent Landmark Interference (FLInt) method. Reference: Sural S, et al. Sci Adv. 2025 Sep 26;11(39):eadw1270. doi: 10.1126/sciadv.adw1270. PMID: 40991693.
|
|
| OH19781 |
C. briggsae |
Cbr-cat-1(ot1621[Cbr-cat-1::SL2::mScarlet3::H2B]) X. Show Description
SL2::mScarlet3::H2B tag inserted after STOP codon of endogenous Cbr-cat-1 locus using CRISPR/Cas9. Generated in C. briggsae AF16 background. Reference: Toker IA, et al. bioRxiv 2024.11.23.624988; doi: https://doi.org/10.1101/2024.11.23.624988.
|
|
| OH19827 |
C. tropicalis |
Ctr-cat-1(ot1631[Ctr-cat-1::SL2::mScarlet3::H2B]) X. Show Description
SL2::mScarlet3::H2B tag inserted after STOP codon of endogenous Ctr-cat-1 locus using CRISPR/Cas9. Generated in C. tropicalis NIC203 background. Reference: Toker IA, et al. bioRxiv 2024.11.23.624988; doi: https://doi.org/10.1101/2024.11.23.624988.
|
|
| OH2211 |
C. elegans |
otEx1184. Show Description
otEx1184 [exl-1p::exl-1::GFP + rol-6(su1006)]. Maintain by picking Rollers. Translational GFP fusion localizes to lysosomal membranes in the intestine and to the Golgi apparatus in neurons and muscle.
|
|
| OH2347 |
C. elegans |
eno-11(ot40) I; oxIs12 X. Show Description
oxIs12 [unc-47p::GFP + lin-15(+)]. Ectopic DVB outgrowth.
|
|
| OH2411 |
C. elegans |
pha-1(e2123) III; otEx233. Show Description
otEx233 [dop-1(prom1)::GFP + pha-1(+)].
|
|
| OH3966 |
C. elegans |
otIs151; otEx2304. Show Description
otIs151 [ceh-36p::RFP + rol-6(su1006)]. Expresses RFP in AWCL/R and ASEL/R. otEx2304 [gcy-11(prom1)::GFP + unc-122::GFP]. Expresses GFP in pharyngeal muscle. Expresses bright GFP in coelomocytes. Rollers. Maintain by picking GFP+.
|
|
| OH4129 |
C. elegans |
jcIs1 IV; wrk-1(ok695) X. Show Description
jcIs1 [ajm-1::GFP + unc-29(+) + rol-6(su1006)] IV. ajm-1 was formerly known as jam-1 (Junction Associated Protein) and "the gene encoding the antigen recognized by the monoclonal antibody MH27." jcIs1 consists of pJS191, C45D3 and pRF4. Reference: Koppen M, et al. Nat Cell Biol. 2001 Nov;3(11):983-91.
|
|
| OH4160 |
C. elegans |
otIs151; otEx2411. Show Description
otIs151 [ceh-36p::RFP + rol-6(su1006)]. Expresses RFP in AWCL/R and ASEL/R. otEx2411[gcy-13(prom1)::GFP + unc-122::GFP]. Expresses GFP in RIM. Expresses bright GFP in coelomocytes. Rollers. Maintain by picking GFP+.
|
|
| OH4329 |
C. elegans |
lsy-6(ot71) dpy-11(e224) V; otEx2322. Show Description
otEx2322[gcy-14(prom1)::GFP + unc-122::GFP]. Faint ASE GFP expression (2 right). Expresses bright GFP in coelomocytes. Dpy.
|
|
| OH4397 |
C. elegans |
otIs151; lsy-6(ot71) dpy-11(e224) V; otEx2419. Show Description
otIs151 [ceh-36p::RFP + rol-6(su1006)]. Expresses RFP in AWCL/R and ASEL/R. otEx2419 [gcy-(prom1)::GFP + unc-122::GFP]. Bilateral expression of GFP in ASE. Expresses bright GFP in coelomocytes. Rollers. Dpy. Maintain by picking GFP+.
|
|
| OH4769 |
C. elegans |
ttx-3(mg158) X; nuIs11. Show Description
nuIs11 [osm-10::GFP + lin-15(+)]. Array contains pool28; KP#57-59 (osm-10::GFP insert at Nrul site) and pJM24 [lin-15(+) rescues n765 at 20C]. GFP expressed in ASH, ASI, PHA and PHB after 3-fold. nuIs11 may be inserted on LG I.
|
|
