Caenorhabditis Genetics Center (CGC)

More Fields
Strain Species Genotype
PS8823 C. elegans dmsr-6(sy1530) II. Show Description
Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of dmsr-6. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). left flanking sequence: ggaatacttactaatttaaaatttttagCCTATA right flanking sequence: CTCTAACGTTCATCCTTTCTTGTCATTCATCCTATG inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: AAGGATGAACGTTAGAGTAT Method Reference: G3 (Bethesda).
PHX4442 C. elegans dmsr-6 (syb4442 [dmsr-6::SL2::GFP::H2B]) I. Show Description
GFP tag inserted at the C-terminus of the endogenous dmsr-6 locus by CRISPR. Allele generated by SUNY Biotech. Reference: Ripoll-Sanchez L, et al. Neuron. 2023 Nov 15;111(22):3570-3589.e5. doi: 10.1016/j.neuron.2023.09.043. PMID: 37935195.