Deletion allele.

C26E6.9a. Homozygous. Outer Left Sequence: TATAGGTCCCCATGGAGCTG. Outer Right Sequence: GGCCTGAATCAAGAAATGGA. Inner Left Sequence: TGCACGGTGAATGATCAAAT. Inner Right Sequence: CATCGGGAAGCTCTTCTGTC. Inner Primer WT PCR product: 3324. Deletion size: 1269 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C26E6.11 Homozygous. Outer Left Sequence: tggatgggtcaaatggtagc. Outer Right Sequence: attgtctgtgtggtgcgaag. Inner Left Sequence: tggcgagtttcacaagaatg. Inner Right Sequence: aattcgctggttcgaagttg. Inner Primer PCR Length: 2404 Estimated Deletion Size: about 400 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C26E6.9. Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Reduced lifespan. Maintain under normal conditions. The parental rbr-2 strain was outcrossed 6x and the parental set-2 strain was outcrossed 2x. Reference: Greer EL et al Nature (2010) doi: 10.1038/nature09195.

Worms are slow growing, with reduced brood size and become sterile at elevated temperatures. met-2 and set-25 mutants co-segregate with ~ 20cM distance. Express GFP::H2B in germline and early embryos. Might still carry unc-119(ed3) in background. Reference: Zeller P, et al. Nat Genet. 2016 Nov;48(11):1385-1395. doi: 10.1038/ng.3672. PMID: 27668659.

Worms are slow growing, with reduced brood size and become sterile at elevated temperatures. CED-1::GFP used to detect apoptotic cells in germline. Reference: Zeller P, et al. Nat Genet. 2016 Nov;48(11):1385-1395. doi: 10.1038/ng.3672. PMID: 27668659.

opIs263 [rpa-1p::rpa-1::YFP + unc-119(+)]. Worms are slow growing with reduced brood size and become sterile at elevated temperatures. Express RPA-1::YFP in both germline and somatic tissues. Reference: Padeken J, et al. Genes Dev. 2019 Apr 1;33(7-8):436-451. PMID: 30804228

lsIs17 [pie-1p::GFP::pcn-1(W03D2.4) + unc-119(+)]. Worms are slow growing with reduced brood size and become sterile at elevated temperatures. Express GFP::PCN-1 in dividing cells of germline, embryos and larvae. Reference: Padeken J, et al. Genes Dev. 2019 Apr 1;33(7-8):436-451. PMID: 30804228

gwIs4 [myo-3p::RFP + baf-1::GFP-lacI:::let-858 3'UTR] X. Worms are slow growing, with reduced brood size and become sterile at elevated temperatures. met-2 and set-25 mutants co-segregate with ~ 20cM distance. Expresses GFP-LacI from early embryogenesis and throughout development, which forms a small spot at the lacO array. RFP expression in muscles. Reference: Towbin BD, et al. Cell. 2012 Aug 31;150(5):934-47. PMID: 22939621

Worms are slow growing with reduced brood size and become sterile at elevated temperatures. Mutants co-segregate with ~ 20cM distance. Reference: Towbin BD, et al. Cell. 2012 Aug 31;150(5):934-47. PMID: 22939621

gwSi17 [cec?4p::cec?4::WmCherry::cec?4 3'UTR] II. gwIs4 [baf-1p::GFP-lacI::let-858 3’UTR + myo-3p::RFP] X. Worms are slow growing with reduced brood size and become sterile at elevated temperatures. Expresses GFP-LacI throughout development from early embryogenesis, forming a large spot at the lacO array. Worms have red muscle (from L1 stage). CEC-4::WmCherry is visible at the nuclear periphery in embryos and L1 stage animals. Reference: Cabianca DS, et al. Nature 2019 May;569(7758):734-739. PMID: 31118512

Reference: Development 134(16):2991-9 (2007).

Contained background Let mutation that was lost during outcrossing. Reference: Development 134(16):2991-9 (2007).

Y24D9A.2. Homozygous. Outer Left Sequence: AATTCGCGAAAACGAAACAA. Outer Right Sequence: ATTGACGGAGAAAAGAGCGA. Inner Left Sequence: CTCCAATGCCTGTAGATGCC. Inner Right Sequence: AAAATTGGGAAAATGGTGGG. Inner Primer PCR Length: 3169 bp. Deletion Size: 1604 bp. Deletion left flank: TTTGCTGGCAGAACAGGGCACATCGACGGA. Deletion right flank: CACTCGGTACGATAAATGGAACAAGGATAT. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Y32F6A.1. Homozygous. Outer Left Sequence: CAATCAAAATGAGTTCGGCA. Outer Right Sequence: TCCTCAACTGATAGACGGGC. Inner Left Sequence: AAATTGGCAACAGACTCAAAAA. Inner Right Sequence: TCTCGATTGAAATTCCCGAG. Inner Primer PCR Length: 3158 bp. Deletion Size: 1483 bp. Deletion left flank: CAACAATGTCTCTTGAGAATTCAAAAATCT. Deletion right flank: AAGATATTTAAATACTTTTAAAACTTTTTA. Insertion Sequence: ATATA. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Y51H4A.12 & Y51H4A.15. Homozygous lethal deletion chromosome balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP ok2136 homozygotes (mid-larval arrest). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: AATCCATTCCACCAATTCCA. External right primer: TTGAAAAATCGGCTTTCAGG. Internal left primer: ACTCCACTTGATTTCCACCG. Internal right primer: AAATTCCTCGCTTTTCGTCA. Internal WT amplicon: 2473 bp. Deletion size: 1621 bp. Deletion left flank: CTTCTGTCGGGAGAATGATTCGGTCCGCGG. Deletion right flank: CAAATATCCTGTATCACGATTTCGACCTGA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Maintain at 20C or lower. The met-2 set-25 double mutant exhibits partial sterility and no significant defects in chromosome segregation. MET-2 and SET-25 are the methyltransferases responsible for histone H3K9me2 and H3K9me3. The deletion mutations can be checked by PCR with the following primers: met-2(ok2307), GGTTGATGCGGAGAAGACTG and AATGGATTCGGTGCTTCGTG; set-25(n5021), GAGCCCGTGCCACAGAGTAG and CCTAGAGCGATGTCCTTGATGG. This strain was used as a negative control in the immunodetection of H3K9me2.