Search Strains

More Fields See WormTagDB for other published tagged loci.
Strain Species Genotype Add
MT14851 C. elegans set-2(n4589) III. Show Description
Deletion allele.
RB1025 C. elegans set-2(ok952) III. Show Description
C26E6.9a. Homozygous. Outer Left Sequence: TATAGGTCCCCATGGAGCTG. Outer Right Sequence: GGCCTGAATCAAGAAATGGA. Inner Left Sequence: TGCACGGTGAATGATCAAAT. Inner Right Sequence: CATCGGGAAGCTCTTCTGTC. Inner Primer WT PCR product: 3324. Deletion size: 1269 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1347 C. elegans set-2(ok1493) III. Show Description
C26E6.11 Homozygous. Outer Left Sequence: tggatgggtcaaatggtagc. Outer Right Sequence: attgtctgtgtggtgcgaag. Inner Left Sequence: tggcgagtttcacaagaatg. Inner Right Sequence: aattcgctggttcgaagttg. Inner Primer PCR Length: 2404 Estimated Deletion Size: about 400 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC974 C. elegans set-2(ok1484) III. Show Description
C26E6.9. Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
ABR9 C. elegans set-2(ok952) III; rbr-2(tm1231) IV. Show Description
Reduced lifespan. Maintain under normal conditions. The parental rbr-2 strain was outcrossed 6x and the parental set-2 strain was outcrossed 2x. Reference: Greer EL et al Nature (2010) doi: 10.1038/nature09195.
ESC818 C. elegans wrdSi23 rpoa-2(cse772[AID*::GFP::rpoa-2]) I; set-2(ok952) III. Show Description
wrdSi23 [eft-3p::TIR1:F2A:mTagBFP::tbb2 3' UTR:: loxP] I. Maintain at 16-20C. AID*::GFP tag inserted at N-terminus of endogenous rpoa-2 locus. This strain can be used for auxin-inducible degradation (AID) of RPOA-2 in somatic tissues in a set-2 mutant background. Reference: Mejia-Trujillo R, et al. bioRxiv 2025.05.07.652530; doi: https://doi.org/10.1101/2025.05.07.652530.
PFR510 C. elegans set-2(bn129)/qC1 [dpy-19(e1259) glp-1(q339) qIs26] III. Show Description
Maintain at 20C or cooler. qIs26 [lag-2::GFP + rol-6(su1006)]. set-2 mutation balanced by glp-1- and dpy-19-marked recombination suppressor. qIs26 was integrated into qC1 and in the process made qC1 homozygous lethal. Heterozygotes are Rollers and GFP+ in the distal tip cell, and segregate WT Rol, lethal qC1 homozygotes, and set-2(bn129) homozygotes (Mrt phenotype at 25C -- viable but homozygotes will become sterile in successive generations). Pick WT GFP+ Rol and check for correct segregation of progeny to maintain. set-2(bn129) homozygotes are short-lived on OP50. bn129 is a deletion removing 748 bp from exon 11 of SET-2L and from exon 3 of SET-2S resulting in a frameshift after 885 aa of SET-2L and after 117 aa of SET-2S with a premature stop four codons later. References: Robert VJ, et al. Front Cell Dev Biol. Dec 2020 Sep 22:8:561791. doi: 10.3389/fcell.2020.561791. PMID: 33072747. Xiao Y, et al. Proc Natl Acad Sci USA. 2011 May 17;108(20):8305-10. doi: 10.1073/pnas.1019290108. PMID: 21527717.
PHX2171 C. elegans set-2(syb2085)/qC1 [dpy-19(e1259) glp-1(q339) qIs26] III. Show Description
Maintain at 20C or cooler. qIs26 [lag-2::GFP + rol-6(su1006)]. set-2 mutation balanced by glp-1- and dpy-19-marked recombination suppressor. qIs26 was integrated into qC1 and in the process made qC1 homozygous lethal. Heterozygotes are Rollers and GFP+ in the distal tip cell, and segregate WT Rol, lethal qC1 homozygotes, and set-2(syb2085) homozygotes (Mrt phenotype at 25C -- viable but homozygotes will become sterile in successive generations). Pick WT GFP+ Rol and check for correct segregation of progeny to maintain. set-2(syb2085) mutant animals that express a catalytically inactive form of SET-2, the C. elegans SET1 homolog. set-2(syb2085) homozygotes are not long-lived on OP50. Reference: Caron M, et al. Life Sci Alliance. Dec 2021, 5 (3) e202101140; DOI: 10.26508/lsa.202101140. PMID: 34893559.
GW1028 C. elegans met-2(n4256) set-25(n5021) III; rrrSi192 [mex-5p::GFP::H2B::tbb-2 3'UTR + unc-119(+)] II. Show Description
Worms are slow growing, with reduced brood size and become sterile at elevated temperatures. met-2 and set-25 mutants co-segregate with ~ 20cM distance. Express GFP::H2B in germline and early embryos. Might still carry unc-119(ed3) in background. Reference: Zeller P, et al. Nat Genet. 2016 Nov;48(11):1385-1395. doi: 10.1038/ng.3672. PMID: 27668659.
GW1203 C. elegans met-2(n4256) set-25(n5021) III; bcIs39 [lim-7p::ced-1::GFP + lin-15(+)] V. Show Description
Worms are slow growing, with reduced brood size and become sterile at elevated temperatures. CED-1::GFP used to detect apoptotic cells in germline. Reference: Zeller P, et al. Nat Genet. 2016 Nov;48(11):1385-1395. doi: 10.1038/ng.3672. PMID: 27668659.
GW1599 C. elegans met-2(n4256) set-25(n5021) III; opIs263. Show Description
opIs263 [rpa-1p::rpa-1::YFP + unc-119(+)]. Worms are slow growing with reduced brood size and become sterile at elevated temperatures. Express RPA-1::YFP in both germline and somatic tissues. Reference: Padeken J, et al. Genes Dev. 2019 Apr 1;33(7-8):436-451. PMID: 30804228
GW1602 C. elegans met-2(n4256) set-25(n5021) III; lsIs17. Show Description
lsIs17 [pie-1p::GFP::pcn-1(W03D2.4) + unc-119(+)]. Worms are slow growing with reduced brood size and become sterile at elevated temperatures. Express GFP::PCN-1 in dividing cells of germline, embryos and larvae. Reference: Padeken J, et al. Genes Dev. 2019 Apr 1;33(7-8):436-451. PMID: 30804228
GW637 C. elegans met-2(n4256) set-25(n5021) III; gwIs4 X. Show Description
gwIs4 [myo-3p::RFP + baf-1::GFP-lacI:::let-858 3'UTR] X. Worms are slow growing, with reduced brood size and become sterile at elevated temperatures. met-2 and set-25 mutants co-segregate with ~ 20cM distance. Expresses GFP-LacI from early embryogenesis and throughout development, which forms a small spot at the lacO array. RFP expression in muscles. Reference: Towbin BD, et al. Cell. 2012 Aug 31;150(5):934-47. PMID: 22939621
GW638 C. elegans met-2(n4256) set-25(n5021) III. Show Description
Worms are slow growing with reduced brood size and become sterile at elevated temperatures. Mutants co-segregate with ~ 20cM distance. Reference: Towbin BD, et al. Cell. 2012 Aug 31;150(5):934-47. PMID: 22939621
GW996 C. elegans gwSi17 set-4(n4600) II; met-2(n4256) set-25(n5021) III; gwIs4 X. Show Description
gwSi17 [cec‐4p::cec‐4::WmCherry::cec‐4 3'UTR] II. gwIs4 [baf-1p::GFP-lacI::let-858 3’UTR + myo-3p::RFP] X. Worms are slow growing with reduced brood size and become sterile at elevated temperatures. Expresses GFP-LacI throughout development from early embryogenesis, forming a large spot at the lacO array. Worms have red muscle (from L1 stage). CEC-4::WmCherry is visible at the nuclear periphery in embryos and L1 stage animals. Reference: Cabianca DS, et al. Nature 2019 May;569(7758):734-739. PMID: 31118512
MT16133 C. elegans set-24(n4909) II. Show Description
Reference: Development 134(16):2991-9 (2007).
MT17463 C. elegans set-25(n5021) III. Show Description
Contained background Let mutation that was lost during outcrossing. Reference: Development 134(16):2991-9 (2007).
RB1796 C. elegans set-21(ok2327) IV. Show Description
Y24D9A.2. Homozygous. Outer Left Sequence: AATTCGCGAAAACGAAACAA. Outer Right Sequence: ATTGACGGAGAAAAGAGCGA. Inner Left Sequence: CTCCAATGCCTGTAGATGCC. Inner Right Sequence: AAAATTGGGAAAATGGTGGG. Inner Primer PCR Length: 3169 bp. Deletion Size: 1604 bp. Deletion left flank: TTTGCTGGCAGAACAGGGCACATCGACGGA. Deletion right flank: CACTCGGTACGATAAATGGAACAAGGATAT. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1831 C. elegans set-22(ok2370) V. Show Description
Y32F6A.1. Homozygous. Outer Left Sequence: CAATCAAAATGAGTTCGGCA. Outer Right Sequence: TCCTCAACTGATAGACGGGC. Inner Left Sequence: AAATTGGCAACAGACTCAAAAA. Inner Right Sequence: TCTCGATTGAAATTCCCGAG. Inner Primer PCR Length: 3158 bp. Deletion Size: 1483 bp. Deletion left flank: CAACAATGTCTCTTGAGAATTCAAAAATCT. Deletion right flank: AAGATATTTAAATACTTTTAAAACTTTTTA. Insertion Sequence: ATATA. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1704 C. elegans set-26&tsr-25(ok2136) IV/nT1 [qIs51] (IV;V). Show Description
Y51H4A.12 & Y51H4A.15. Homozygous lethal deletion chromosome balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP ok2136 homozygotes (mid-larval arrest). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: AATCCATTCCACCAATTCCA. External right primer: TTGAAAAATCGGCTTTCAGG. Internal left primer: ACTCCACTTGATTTCCACCG. Internal right primer: AAATTCCTCGCTTTTCGTCA. Internal WT amplicon: 2473 bp. Deletion size: 1621 bp. Deletion left flank: CTTCTGTCGGGAGAATGATTCGGTCCGCGG. Deletion right flank: CAAATATCCTGTATCACGATTTCGACCTGA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
ZT62 C. elegans met-2(ok2307) set-25(n5021) III. Show Description
Maintain at 20C or lower. The met-2 set-25 double mutant exhibits partial sterility and no significant defects in chromosome segregation. MET-2 and SET-25 are the methyltransferases responsible for histone H3K9me2 and H3K9me3. The deletion mutations can be checked by PCR with the following primers: met-2(ok2307), GGTTGATGCGGAGAAGACTG and AATGGATTCGGTGCTTCGTG; set-25(n5021), GAGCCCGTGCCACAGAGTAG and CCTAGAGCGATGTCCTTGATGG. This strain was used as a negative control in the immunodetection of H3K9me2.