GFP tag inserted at the C-terminus of the endogenous frpr-19 locus by CRISPR. Allele generated by SUNY Biotech. Please contact Oliver Hobert prior to publishing work using this strain.

Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of frpr-19. Universal 43 bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). left flanking sequence: GATGATTGGCTCAACAGAGGTGCCGTTGTTTGAGG right flanking sequence: AGGAGGATATGTGTACACCACTCAACATTTCTTGTG inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: GGTGCCGTTGTTTGAGGAGG Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616