More Fields
Strain Species Genotype
HBR2317 C. elegans nlp-8(syb762) IV. Show Description
syb762 is a 1076 bp deletion in nlp-8. Flanking sequences: taaaacccggaacc - acttcttgaacaactg Forward primer: TAAAAGCGGAGTAGCGTCCA Reverse primer: CAGATGGTCGGGTGATTTGA syb762 was generated in a mutant background and out-crossed to N2 to remove those background mutations. Reference: Sinner MP, et al. Curr Biol. 2021 Feb 8;31(3):564-577.e12. PMID: 33259791
VC1309 C. elegans nlp-8(ok1799) I. Show Description
D2005.2. Superficially wild type. External left primer: TCGGAAATGATTCATAGGGC. External right primer: TCACACCTCATACCCCCATT. Internal left primer: CTTTCAAATCACCCGACCAT. Internal right primer: TTCTTGATCTACCCGAACCG. Internal WT amplicon: 2229 bp. Deletion size: 695 bp. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
PHX1446 C. elegans nlp-8(syb762) I; nlp-32(syb431) cnc- 6(syb393) III, Y43C5A.3(syb761) IV; sybDf2 sybDf1 cnc-10(syb937) nlp-25(syb579) cnc-7(syb558) V. Show Description
Reduced survival after wounding. PHX1446 carries knockouts of 19 members of the nlp and cnc peptide families. sybDf1 is a deletion of a gene cassette including nlp-34, nlp-31, nlp-30, nlp-29, nlp-28, and nlp-27. sybDf2 is a deletion of a gene cassette including cnc-11, cnc-1, cnc-5, cnc-4, cnc-3, and cnc-2. Reference: Sinner MP, et al. Curr Biol. 2021 Feb 8;31(3):564-577.e12. PMID: 33259791
OH15655 C. elegans otIs711. Show Description
otIs711 [nlp-8p::GFP + lin-15(+)]. Reference: The enteric nervous system of C. elegans is specified by the Sine Oculis-like homeobox gene ceh-34. Vidal B, et al. bioRxiv 2021.11.30.470650; doi:
PS8307 C. elegans nlp-80(sy1264) V. Show Description
Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of nlp-80; Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: CTTCTCTTGTGTATTCTGTTTGCTTTATCCGAAG Right flanking sequence: CTTACAGTCGCATGGAGTTGGAgtaagttaagaac inserted sequence between the two flanking sequence (STOP-In casette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA : CTCCATGCGACTGTAAGCTT Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616
PS8311 C. elegans nlp-82(sy1266) II. Show Description
Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of nlp-82; Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: cattttccaactataaattttacagATGCCGTCA Right flanking sequence: TACCACACTGTAATCATCATCCTGCTCATCTCAAT inserted sequence between the two flanking sequence (STOP-In casette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA : ATGATTACAGTGTGGTATGA Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616