| HW1826 |
C. elegans |
lin-29(xe63[gfp::3xflag::lin-29a]) II. Show Description
Superficially wild-type. CRISPR/Cas9-engineered allele adds GFP and 3xflag tag to the N-terminus of LIN-29A. Do not distribute this strain; other labs should request it directly from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects. Reference: Aeschimann F, et al., (2019). A single let-7 target to coordinate transition to adulthood. Life Science Alliance 2, e201900335. http://dx.doi.org/10.26508/lsa.201900335 )
|
|
| HW1870 |
C. elegans |
lin-41(xe8)/lin-41(bch28[eft-3p::gfp::h2b::tbb-2 3'UTR] xe70) I. Show Description
Pick GFP+ Egl to maintain. Segregates GFP- lin-41(xe8) homozygotes (die by vulval bursting as young adults), lin-41(xe8)/lin-41(bch28[eft-3p::gfp::h2b::tbb-2 3'UTR] xe70) heterozygotes (GFP+ Egl), and lin-41(bch28[eft-3p::gfp::h2b::tbb-2 3'UTR] xe70) (GFP+ Ste Dpy). lin-41(xe8) is a deletion of let-7 binding sites in the lin-41 3'UTR. The balancer was derived from lin-41(bch28), a lin-41(0) allele in which an expression cassette that drives ubiquitous nuclear GFP from the eft-3 promoter has been inserted into the lin-41 coding sequence (Katic et al., G3 (2015) 5:1649-56). References: Katic et al., G3 (2015) 5:1649-56 for lin-41(bch28) starting allele for balancer generation. Aeschimann F, et al. (2019). A single let-7 target to coordinate transition to adulthood. Life Science Alliance 2, e201900335. for balanced line. Do not distribute this strain; other labs should request it directly from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
|
|
| HY483 |
C. elegans |
bre-3(ye26) III. Show Description
Resistant to Cry5B Bt toxin.
|
|
| HY485 |
C. elegans |
bre-4(ye27) IV. Show Description
Resistant to Cry5B Bt toxin. See also WBPaper00004776.
|
|
| JA1334 |
C. elegans |
unc-119(e2498) III; weIs11. Show Description
weIs11[unc-119(+) + TAC-1::GFP].
|
|
| JA1354 |
C. elegans |
unc-119(e2498) III; weIs12. Show Description
weIs12[unc-119(+) + pie-1p::GFP::csnk-1].
|
|
| JA1403 |
C. elegans |
unc-119(e2498) III; weIs15. Show Description
weIs15 [pie-1p::GFP::eea-1(FYVEx2) + unc-119(+)]. Phenotypically wild type. Early endosomes in germline and embryos are GFP+. GFP is fused to the tandem FYVE domains of eea-1/T10G3.5, under control of the pie-1 promoter. Grows at any temp, but has bright GFP at 25C.
|
|
| JCP152 |
C. elegans |
dpy-11(e224) ccz-1(t2129) V; jcpEx2. Show Description
jcpEx2 [ced-1p::F58G11.6(genomic)::YFP::let-858 3'UTR + unc-119(+) + myo-2::GFP]. Maintain by picking GFP+. Individuals that lost the array produce only arrested embryos with spindle orientation defects, accumulate vesicles, and problems engulfing apoptotic corpses. Reference: Nieto C, et al. J Cell Sci. 2010 Jun 15;123(Pt 12):2001-7.
|
|
| JCP169 |
C. elegans |
dpy-11(e224) ccz-1(t2129) V; jcpEx3. Show Description
jcpEx3 [ccz-1p::ccz-1(genomic)::YFP::let-858 3'UTR + unc-119(+) + pha-1(+)]. Array rescues lethality. Individuals that lost the array produce only arrested embryos with spindle orientation defects, accumulate vesicles, and problems engulfing apoptotic corpses. Reference: Nieto C, et al. J Cell Sci. 2010 Jun 15;123(Pt 12):2001-7.
|
|
| JCP53 |
C. elegans |
dpy-11(e224) ccz-1(t2129) V/nT1 [qIs51] (IV;V). Show Description
Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP ccz-1 homozygotes (produce only arrested embryos with spindle orientation defects, accumulate vesicles, and problems engulfing apoptotic corpses). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. Reference: Nieto C, et al. J Cell Sci. 2010 Jun 15;123(Pt 12):2001-7.
|
|
| JH3296 |
C. elegans |
mex-5(ax3050[mCherry::mex-5]) IV. Show Description
mCherry tag inserted into endogenous mex-5 locus. References: Smith J, et al. eLife. 2016 Dec 3;5:e21337. doi: 10.7554/eLife.21337. PMID: 27914198.
|
|
| JH3475 |
C. elegans |
meg-3(ax3055) meg-4(ax3052) X. Show Description
Embryonic P granules not segregated, 30% maternal effect sterility on average, RNAi insensitivity. meg-3(ax3055) and meg-4(ax3052) are precise deletions of the entire coding sequence made by CRISPR/Cas9, designed to be cut again to make insertions at the endogenous locus. References: Smith, J. et al. Elife. 2016 Dec 3;5:e21337. doi: 10.7554/eLife.21337. PMID: 27914198 Ouyang JPT, et al. Dev Cell. 2019 Sep 23;50(6):716-728.e6. PMID: 31402283
|
|
| JH3477 |
C. elegans |
meg-3(ax3051[meg-3::OLLAS]) meg-4(ax3052) X. Show Description
P granule size reduced, detection of MEG-3 by anti-OLLAS antibody. References: Smith, J. et al. Elife. 2016 Dec 3;5:e21337. doi: 10.7554/eLife.21337. PMID: 27914198 Schmidt H, bioRxiv 2020.10.15.340570 (2020) doi:10.1101/2020.10.15.340570.
|
|
| JH3503 |
C. elegans |
meg-3(ax3054[meg-3::meGFP]) X. Show Description
meGFP inserted between P121 and V122 of endogenous MEG-3. Reference: Putnam A, et al. Nat Struct Mol Biol. 2019 Mar;26(3):220-226. Smith et al. Elife. 2016 Dec 3;5. pii: e21337.
|
|
| JH3553 |
C. elegans |
meg-3(ax4503[del(1-544)::OLLAS]) meg-4(ax4504) X. Show Description
Description: 20% maternal effect sterility on average, RNAi insensitivity, MEG-3 does not form cytoplasmic gradient. meg-3(ax4503) is an in-frame deletion in the endogenous meg-3 locus removing amino acids (1-544); MEG-3 does not form a cytoplasmic gradient but does still form granules in early embryos and co-localizes with PGL-3. References: Smith, J. et al. Elife. 2016 Dec 3;5:e21337. doi: 10.7554/eLife.21337. PMID: 27914198 Schmidt H, bioRxiv 2020.10.15.340570 (2020) doi:10.1101/2020.10.15.340570.
|
|
| JH3678 |
C. elegans |
mex-5(ax3050[mCherry::mex-5])/nT1[qIs51] IV; par-1(ax4209[par-1(T983A)::meGFP])/nT1[qIs51] V. Show Description
qIs51 [myo-2p::GFP + pes-10p::GFP + F22B7.9p::GFP]. Heterozygotes are wild-type myo-2::GFP+ and segregate non-myo-2::GFP ax3050; ax4209 homozygotes (maternal effect lethal), wild-type myo-2::GFP+ heterozygotes, and arrested nT1[qIs51] aneuploids. Pick wild-type myo-2::GFP+ and check for correct segregation of progeny to maintain. References: Smith J, et al. eLife. 2016 Dec 3;5:e21337. doi: 10.7554/eLife.21337. PMID: 27914198. Folkman A, et al. Development. 2019 Mar 25;146(6):dev171116. doi: 10.1242/dev.171116. PMID: 30814118.
|
|
| JH3679 |
C. elegans |
mex-5(ax3050[mCherry::mex-5]) IV; par-1(ax4206[par-1::meGFP]) V. Show Description
qIs51 [myo-2p::GFP + pes-10p::GFP + F22B7.9p::GFP]. Homozygous mex-5(ax3050[mCherry::mex-5]); par-1(ax4206[par-1::meGFP]) animals are fully viable and fertile. References: Smith J, et al. eLife. 2016 Dec 3;5:e21337. doi: 10.7554/eLife.21337. PMID: 27914198. Folkman A, et al. Development. 2019 Mar 25;146(6):dev171116. doi: 10.1242/dev.171116. PMID: 30814118.
|
|
| JH3861 |
C. elegans |
meg-3(ax4502[meg-3(F705A,Y708A,Y713A, N725A)::OLLAS]) meg-4(ax3052) X. Show Description
20% Maternal effect sterility on average, embryonic P granule defect, RNAi insensitivity. Engineered mutations in the endogenous meg-3 locus disrupt the binding and localization of PGL proteins to P granules in the early embryo while MEG-3 itself is still forms an asymmetric cytoplasmic gradient and granules. References: Smith, J. et al. Elife. 2016 Dec 3;5:e21337. doi: 10.7554/eLife.21337. PMID: 27914198 Schmidt H, bioRxiv 2020.10.15.340570 (2020) doi:10.1101/2020.10.15.340570.
|
|
| JJ1014 |
C. elegans |
mex-3(zu155) dpy-5(e61)/hT1 I; pos-1(zu148) unc-42(e270)/hT1 V. Show Description
The double heterozygote is WT. WT will segregate WT, DpyUncs, mid-larval lethal (hT1 homozygotes) and dead eggs. The DpyUncs are homozygous for zu155 and zu148 and will segregate only dead embryos; the dead embryos have excess hypodermis and muscle and lack germ cells and intestine.
|
|
| JJ1136 |
C. elegans |
unc-119(e2498) III; zuEx24. Show Description
zuEx24 [hmp-1::GFP + unc-119(+)]. Animals with the duplication are WT. Occasionally pick green hermaphrodites to maintain. zuEx24 transmits at a very high frequency.
|
|
| JJ1972 |
C. elegans |
eel-1(zu462) unc-33(e204) IV. Show Description
Slow growth and a maternal-effect enhancer of the efl-1(se1) embyronic lethal phenotype. Unc.
|
|
| JJ462 |
C. elegans |
+/nT1 IV; pos-1(zu148) unc-42(e270)/nT1 V. Show Description
Heterozygotes are WT and segregate WT, Uncs, Vul and dead eggs. Uncs are homozygous for zu148 and will segregate only dead embryos; the dead embryos will have no morphogenesis and will lack germ cells and intestine.
|
|
| JJ746 |
C. elegans |
+/nT1 IV; apx-1(zu183) dpy-11(e224)/nT1 V. Show Description
Heterozygotes are WT and segregate WT, Dpy, Vul and dead eggs. The Dpys give only dead eggs. apx-1 is a maternal effect lethal. zu183 is recessive.
|
|
| JK1223 |
C. elegans |
lag-2(q411) V/nT1 [unc-?(n754) let-?] (IV;V). Show Description
Heterozygotes are Unc. [Used to be listed in Kimble lab as unc-5(e53); lag-2(q411 dpy-11(e224)/DnT1. Needs to be checked.] Do not distribute this strain; other labs should request it from the CGC.
|
|
| JK1505 |
C. elegans |
unc-32(e189) glp-1(e2072) III/eT1 (III;V). Show Description
Heterozygotes are WT and segregate WT, Sterile Unc coilers, Unc-36s (eT1 homozygotes) and dead eggs. Pick WT to maintain. Do not distribute this strain; other labs should request it from the CGC.
|
|
| JK1774 |
C. elegans |
eef-1A.1(q145)/sma-3(e491) unc-36(e251) III. Show Description
Heterozygotes are WT and segregate WT, SmaUnc and Steriles. Do not distribute this strain; other labs should request it from the CGC. eft-3(q145) previously called glp-3(q145).
|
|
| JK2663 |
C. elegans |
dpy-11(e224) mes-4(bn67) V/nT1 [unc-?(n754) let-? qIs50] (IV;V). Show Description
qIs50 is an insertion of ccEx9747 with markers: myo-2::GFP expressed brightly in the pharynx throughout development, pes-10::GFP expressed in embryos, and a gut promoter (F22B7.9) driving GFP in the intestine. Segregates non-glowing Dpys that are Mes (produce only sterile progeny) and glowing Unc heterozygotes. nT1[unc-?(n754) let-? qIs50] is also known as DnT1[qIs50]. qIs50 is apparently inserted on DnT1. qIs50 is somewhat dimmer than the similar qIs51. Do not distribute this strain; other labs should request it directly from the CGC.
|
|
| JK289 |
C. elegans |
glp-1(e2142) III. Show Description
Temperature sensitive. Maintain at 15C.
|
|
| JK2958 |
C. elegans |
nT1 [qIs51] (IV;V)/dpy-11(e224) unc-42(e270) V. Show Description
Segregates glowing heterozygotes and DpyUncs. nT1[qIs51] is probably homozygous lethal. qIs51 is an insertion of ccEx9747 with markers: myo-2::GFP expressed in the pharynx throughout development, pes-10::GFP expressed in the embryo, and a gut promoter F22B7.9::GFP expressed in the intestine. Crosses with this strain generate very few glowing hermaphrodite cross progeny and many glowing male cross progeny. Do not distribute this strain; other labs should request it directly from the CGC.
|
|
| JK3140 |
C. elegans |
gon-1(e2551) IV/nT1 [qIs51] (IV;V). Show Description
Heterozygotes are WT and GFP+. Segregate Gon worms which are GFP-. nT1[qIs51] homozygotes are inviable. Do not distribute this strain; other labs should request it from the CGC.
|
|
| JK3447 |
C. elegans |
fog-1(q250)/sep-1(e2406) I; fbf-1(ok91) fbf-2(q704)/mIn1 [mIs14 dpy-10(e128)] II. Show Description
To maintain, check individual fertile worms for both Sep and Fog offspring. sep-1 homozygotes are sterile at 20C and 25C (Sterile and Unc at 25C), and mostly normal at 15C. fog-1; fbf-1 fbf-2 homozygotes have small germ lines and are often Muv. Best to maintain at 25C for scoring. Do not distribute this strain; other labs should request it from the CGC.
|
|
| JK4143 |
C. elegans |
qIs57 II; rde-1(ne219) V; qIs140. Show Description
qIs57 [lag-2p::GFP] II. qIs140 [lag-2p::rde-1 + rol-6(su1006)]. Rollers. qIs140 rescues rde-1 in lag-2-expressing cells (as tested by GFP RNAi). qIs57 GFP expression in DTCs. Do not distribute this strain; other labs should request it directly from the CGC.
|
|
| JK867 |
C. elegans |
dpy-17(e164) ncl-1(e1865) unc-36(e251) III; qDp3 (III;f). Show Description
Animals which have the Duplication are Dpy. Animals which have lost the Duplication are DpyUncNcl. qDp3 homozygotes are lethal. Maintain by picking Dpy non-Unc. Do not distribute this strain; other labs should request it from the CGC.
|
|
| JLF14 |
C. elegans |
gip-1(wow3[GFP::gip-1]) III Show Description
GFP tag inserted into endogenous gip-1 locus. No overt phenotypes. GFP fluorescence is observed at microtubule-organizing centers. Reference: Sallee M, et al. PLoS Biol. 2018 Aug 6;16(8):e2005189. doi: 10.1371/journal.pbio.2005189. PMID: 30080857.
|
|
| JLF145 |
C. elegans |
zif-1(gk117) III; air-1(wow14[air-1::ZF1::GFP::3xFLAG]) V. Show Description
ZF1-degron, GFP, and 3xFLAG tags inserted into endogenous air-1 locus. No overt phenotypes in a zif-1(gk117) background. Predicted no degradation because zif-1 putative null is present. Can be used for degradation of air-1 protein by providing a source of ZIF-1. GFP expression is observed in mitotic cells at the spindle poles and along microtubules. Reference: Sallee M, et al. PLoS Biol. 2018 Aug 6;16(8):e2005189. doi: 10.1371/journal.pbio.2005189. PMID: 30080857.
|
|
| JLF16 |
C. elegans |
ptrn-1(wow4[ptrn-1::GFP]) X. Show Description
GFP tag inserted into endogenous ptrn-1 locus. No overt phenotypes. GFP fluorescence is observed at non-centrosomal microtubule-organizing centers, including the apical surface of intestinal cells. Reference: Sallee M, et al. PLoS Biol. 2018 Aug 6;16(8):e2005189. doi: 10.1371/journal.pbio.2005189. PMID: 30080857.
|
|
| JLF173 |
C. elegans |
gip-1(wow25[tagRFP-T::3xMyc::gip-1]) zif-1(gk117) III. Show Description
tagRFP-T and 3xMyc tags inserted into endogenous gip-1 locus. No overt phenotypes. RFP fluorescence is observed at microtubule-organizing centers, though generally much dimmer than the GFP allele gip-1(wow3). Reference: Sallee M, et al. PLoS Biol. 2018 Aug 6;16(8):e2005189. doi: 10.1371/journal.pbio.2005189. PMID: 30080857.
|
|
| JLF24 |
C. elegans |
gip-1(wow5[ZF1::GFP::gip-1]) zif-1(gk117) III. Show Description
ZF1-degron and GFP tags inserted into endogenous gip-1 locus. No overt phenotypes in a zif-1(gk117) background. Predicted no degradation because zif-1 putative null is present. Can be used for degradation of gip-1 protein by providing a source of ZIF-1. GFP fluorescence is observed at microtubule-organizing centers. Presence of ZF1-degron targets tagged proteins for ZIF-mediated degradation. Expression of ZIF-1 causes the tagged GIP-1 protein to be degraded. Reference: Sallee M, et al. PLoS Biol. 2018 Aug 6;16(8):e2005189. doi: 10.1371/journal.pbio.2005189. PMID: 30080857.
|
|
| JLF302 |
C. elegans |
ebp-2(wow47[ebp-2::GFP::3xFLAG]) II; zif-1(gk117) III. Show Description
GFP and 3xFLAG tags inserted into endogenous ebp-2 locus. No overt phenotypes. GFP fluorescence is observed the tips of growing microtubules. Reference: Sallee M, et al. PLoS Biol. 2018 Aug 6;16(8):e2005189. doi: 10.1371/journal.pbio.2005189. PMID: 30080857.
|
|
| JLF348 |
C. elegans |
mzt-1(wow51[GFP::3xFLAG::mzt-1]) I; zif-1(gk117) III. Show Description
GFP and 3xFLAG tags inserted into endogenous mzt-1 locus. No overt phenotypes. GFP fluorescence is observed at microtubule-organizing centers. Reference: Sallee M, et al. PLoS Biol. 2018 Aug 6;16(8):e2005189. doi: 10.1371/journal.pbio.2005189. PMID: 30080857.
|
|
| JN2722 |
C. elegans |
daf-2(pe2722) III. Show Description
daf-2(pe2722) is a daf-2c-isoform specific mutation. pe2722 is a CRISPR/Cas9-engineered 41 bp deletion (ggttgatgacgatgatgagcccggcggcaggaggcagtgagcaaca) in daf-2 exon 11.5. Guide RNA sequence: gacgatgaagagcccggcgg. Reference: Nagashima T, et al. PLoS Genet. 2019 Jul 19;15(7):e1008297. PMID: 31323047
|
|
| JPS1809 |
C. elegans |
vxIs601; bcIs49. Show Description
bcIs49 [egl-1p::mitoGFP]. vxIs601 [egl-1p::mCherry::egl-1 3'UTR + unc-122p::GFP]. Transcriptional reporter for apoptotic trigger egl-1. mCherry expression in URX adult neurons through adult stage. Transient mCherry expression in apoptotic cells before death. Reference: Wu Z, et al. Proc Natl Acad Sci U S A. 2025 Jan 14;122(2):e2407909122. doi: 10.1073/pnas.2407909122. PMID: 39786930.
|
|
| JPS725 |
C. elegans |
ced-6(n1813) III; vxEx725. Show Description
vxEx725 [egl-1p::mCherry::egl-1(G55E, F65D)::egl-1 3'UTR + gcy-32p::GFP::unc-54 3'UTR + unc-122p::GFP]. Pick animals with GFP expression in coelomocytes to maintain. mCherry-tagged EGL-1 visible in URX adult neurons and apoptotic cells. G55E and F65D mutations in the BH3-only region to abolish mCherry::EGL-1 function in inducing cell death. Reference: Wu Z, et al. Proc Natl Acad Sci U S A. 2025 Jan 14;122(2):e2407909122. doi: 10.1073/pnas.2407909122. PMID: 39786930.
|
|
| JR113 |
C. elegans |
sma-1(e30) unc-76(e911) wDf2/sqt-3(sc8) unc-61(e228) V. Show Description
Heterozygotes are WT and segregate WT, RolUncs and dead eggs. Homozygous wDf1 embryos arrest uniformly as unenclosed balls of differentiated cells. wDf2 formerly called zen-1(w1). sc8 previously called rol-4(sc8).
|
|
| JR2750 |
C. elegans |
bli-6(sc16) unc-22(e66)/unc-24(e138) vha-17(w13) dpy-20(e2017) IV. Show Description
Pick wild type animals to maintain.
|
|
| JR36 |
C. elegans |
cdl-1(e2510)/mnC1 [dpy-10(e128) unc-52(e444)] II. Show Description
Heterozygotes are WT and segregate WT, dead eggs (homozygous cdl-1(e2510), and Dpy Unc. e2510 carries a missense mutation at the 249th amino acid from Pro to Ser.
|
|
| JR41 |
C. elegans |
unc-76(e911) wDf1/unc-61(e228) dpy-21(e428) V. Show Description
Heterozygotes are WT and segregate WT, DpyUncs and dead eggs. Homozygous wDf1 embryos arrest uniformly as unenclosed balls of differentiated cells. wDf1 formerly called zen-1(e2482). 2/02: dpy-21 appears to have been lost from this strain.
|
|
| JR667 |
C. elegans |
unc-119(e2498::Tc1) III; wIs51 V. Show Description
wIs51 [SCMp::GFP + unc-119(+)] V. GFP expression in seam cells. Superficially wild-type.
|
|
| JR728 |
C. elegans |
sqt-3(sc8) unc-61(e228)/wDf4 V. Show Description
Pick WT to maintain. Throws WT, Roller Uncs and dead eggs. wDf4 arrests as dead eggs with no gut. sc8 previously called rol-4(sc8).
|
|
| JR8 |
C. elegans |
die-1(e2500)/mnC1 [dpy-10(e128) unc-52(e444)] II; him-8(e1489) IV. Show Description
Heterozygotes are WT and segregate WT, paralyzed Dpys, and arrested embryos. Throws males. e2500 pka zen-2(e2500).
|
|