More Fields
Strain Species Genotype
DCL569 C. elegans mkcSi13 II; rde-1(mkc36) V. Show Description
mkcSi13 [sun-1p::rde-1::sun-1 3'UTR + unc-119(+)] II. Germline rescue of the rde-1(mkc36) indel mutation, allowing germline-specific RNAi. Reference: Zou L, et al. Scientific Reports Volume 9, Article number: 2354 (2019) "Construction of a germline-specific RNAi tool in C. elegans."
IG1839 C. elegans frSi17 II; frIs7 IV; rde-1(ne300) V. Show Description
frSi17 [mtl- 2p::rde-1 3'UTR] II. frIs7 [nlp-29p::GFP + col-12p::DsRed] IV. frSi17 inserted into ttTi5605 site using CRISPR/Cas9 engineering. RDE-1 activity is rescued in the intestine, making animals RNAi-deficient except for intestinal tissues. Reference: https://www.g3journal.org/content/early/2020/09/17/g3.120.401749
IG1846 C. elegans frSi21 II; frIs7 IV; rde-1(ne300) V. Show Description
frSi21 [col-62p::rde-1 3'UTR] II. frIs7 [nlp-29p::GFP + col-12p::DsRed] IV. frSi21 inserted into ttTi5605 site using CRISPR/Cas9 engineering. RDE-1 activity is rescued in adult epidermal tissues, making animals RNAi-deficient except for hypodermal (skin) tissues from the young adult stage. The frSi21 insertion can be detected using a primer within the inserted vector but outside the genomic rde-1 sequence included in the transgene (jep3108: ATcttgtgaccgaactgtcc) in combination with downstream primer (jep2445: caaaaaggcgggatgagcag), producing a 965 bp product if insertion is present. rde-1(ne300) can be genotyped by sequencing the PCR product from jep2299: gaacaacgacaatcgagcacca and jep3108: ATcttgtgaccgaactgtcc. Reference: https://www.g3journal.org/content/early/2020/09/17/g3.120.401749
WM27 C. elegans rde-1(ne219) V. Show Description
RNAi deficient.
WM45 C. elegans rde-1(ne300) V. Show Description
RNAi deficient. Reference: Tabara H, et al. Cell 1999 Oct 15:99(2):123-32.
JU2039 C. elegans mfIs70 IV; rde-1(ne219) V. Show Description
mfIs70 [lin-31p::rde-1 + myo2p::GFP]. mfIs70 is a spontaneous integration in LG IV. Superficially wild-type. This strain can be used for Pn.p-specific RNAi. Reference: Barkoulas et al. (2013) Developmental Cell Jan 14;24(1):64-75
QK52 C. elegans rde-1(ne219) V; xkIs99. Show Description
xkIs99 [wrt-2p::rde-1::unc-54 3'UTR]. NOTE: This strain was originally published as JM43 in Melo JA, Ruvkun G. Reference: Melo JA, Ruvkun G. Cell. 2012 Apr 13;149(2):452-66.
SD1989 C. elegans rde-1(ne300) V; gaIs290. Show Description
gaIs290 [elt-2::TY1::EGFP::3xFLAG(92C12) + unc-119(+)]. RNAi-resistant. TY1::EGFP::3xFLAG tag inserted in frame at C-terminus of coding sequence by recombineering. Recombineered fosmid was integrated by biolistic bombardment. References: Sarov, M, et al. Nat Methods (2006) 10:839-44. Mann F, et al. PLoS. Strain was constructed as part of the Regulatory Element Project, part of modENCODE (http://www.modencode.org)
WM118 C. elegans rde-1(ne300) V; neIs9 X. Show Description
neIs9 [myo-3::HA::RDE-1 + rol-6(su1006)]. Transgene rescues muscle RNAi defect. Rollers.
AMJ345 C. elegans jamSi2 II; rde-1(ne219) V. Show Description
jamSi2 [mex-5p::rde-1(+)] II. mex-5p::rde-1(+) inserted into ttTi5605 on LG II. Tissue-specific RNAi rescue allows silencing in germline and intestine. Reference: Marre JA, et al. Proc Natl Acad Sci USA. 2016.
JK4143 C. elegans qIs57 II; rde-1(ne219) V; qIs140. Show Description
qIs57 [lag-2p::GFP] II. qIs140 [lag-2p::rde-1 + rol-6(su1006)]. Rollers. qIs140 rescues rde-1 in lag-2-expressing cells (as tested by GFP RNAi). qIs57 GFP expression in DTCs. Do not distribute this strain; other labs should request it directly from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
NR221 C. elegans rde-1(ne219) V; kzIs8. Show Description
kzIs8 [lin-26p::NLS::GFP + rol-6(su1006)]. Maintain by picking Rollers.
NR350 C. elegans rde-1(ne219) V; kzIs20. Show Description
kzIs20 [hlh-1p::rde-1 + sur-5p::NLS::GFP]. Muscle specific RNAi. kzIs20 genotype differs from published data; this information is correct per Hiroshi Qadota.
SD1954 C. elegans rde-1(ne219) V; kzIs9; wgIs600. Show Description
kzIs9 [(pKK1260) lin-26p::NLS::GFP + (pKK1253) lin-26p::rde-1 + rol-6(su1006)]. Rollers. Hypodermis specific RNAi. wgIs600 [unc-62::TY1::EGFP::3xFLAG(92C12) + unc-119(+)]. TY1::EGFP::3xFLAG tag inserted in frame at C-terminus of coding sequence by recombineering.
VP303 C. elegans rde-1(ne219) V; kbIs7. Show Description
kbIs7 [nhx-2p::rde-1 + rol-6(su1006)]. Rollers. RNAi effective only in intestine. Maintain under normal conditions. Reference: Espelt MV, et al., J Gen Physiol. 2005 Oct;126(4):379-92.
WM28 C. elegans unc-32(e189) III; rde-1(ne219) V. Show Description
RNAi deficient. Unc.
JU2058 C. elegans rrf-3(pk1426) II; mfIs70 IV; rde-1(ne219) V. Show Description
mfIs70 [lin-31p::rde-1 + myo2p::GFP]. mfIs70 is a spontaneous integration in LG IV. Superficially wild-type. This strain can be used for Pn.p-specific RNAi. Reference: Barkoulas et al. (2013) Developmental Cell Jan 14;24(1):64-75
NK2115 C. elegans cpIs121 I; rrf-3(pk1426) II; rde-1(ne219) V. Show Description
cpIs121 [lag-2p::mNG::PH::F2A::rde-1] I. Temperature-sensitive: maintain at 16-20C. RNAi-response variant. RNAi-hypersensitized DTC-specific RNAi strain that labels all rde-1(+) cells with mNeonGreen. Reference: Linden LM, et al. Dev Biol. 2017 Sep 1;429(1):271-284.
NR222 C. elegans rde-1(ne219) V; kzIs9. Show Description
kzIs9 [(pKK1260) lin-26p::NLS::GFP + (pKK1253) lin-26p::rde-1 + rol-6(su1006)]. Rollers. Hypodermis specific RNAi.
RA382 C. elegans rdIs7 I; unc-119(ed3) III; rde-1(ne219) V. Show Description
rdIs7 [hnd-1::rde-1 + unc-119(+)] I. Rescued for RNAi in the mesoderm and SGPs. Reference: Large EE and Mathies LD. G3 (Bethesda). 2014 Mar 20;4(3):471-83.
SD1963 C. elegans unc-119(ed3) III; rde-1(ne300) V; gaEx234. Show Description
gaEx234 [elt-2p::elt-2::GFP + unc-119(+)]. Pick non-Unc to maintain. Long-lived. Overexpression of ELT-2. RNAi-resistant. Reference: Mann F, et al. PLoS.
SD1965 C. elegans unc-119(ed3) III; rde-1(ne300) V; gaEx233. Show Description
gaEx233 [unc-119(+)]. Pick non-Unc to maintain. Reference: Mann F, et al. PLoS.
TU3135 C. elegans mec-8(u218) I; rde-1(ne219) V; uIs46. Show Description
uIs46 [rde-1p::mec-2(intron9)::rde-1) + ceh-22::GFP]. Temperature sensitive; maintain at 15 C. RNAi-sensitive at 15 C. Mechanosensory abnormal at 25 C. Uses the ninth intron of mec-2, whose splicing depends on mec-8, to produce temperature-sensitive expression and temperature-sensitive RNAi. Reference: Calixto et al. (2010) Nature Methods 7:407-11.
BB23 C. elegans adr-1(gv6) I; adr-2(gv42) III; rde-1(ne219) V. Show Description
RNAi deficient. Maintain under normal conditions. Reference: Tonkin LA & BassBL. Science. 2003 Dec 5;302(5651):1725. Knight SW & Bass BL. Mol Cell. 2002 Oct;10(4):809-17.
BB242 C. elegans adr-1(uu49) I; adr-2(uu28) III; rde-1(uu51) V. Show Description
RNAi deficient. Lacks RNA editing. Reference: Reich DP, et al. Genes Dev. 2018 Feb 1;32(3-4):271-282.
NK640 C. elegans rrf-3(pk1426) II; unc-119(ed4) III; rde-1(ne219) V; qyIs102. Show Description
qyIs102 [fos-1ap::rde-1(genomic) + myo-2::YFP + unc-119(+)]. Uterine-specific RNAi.
NK741 C. elegans rrf-3(pk1426) II; unc-119(ed4) III; rde-1(ne219) V; qyIs138. Show Description
qyIs138 [unc-62p::rde-1(genomic) + myo-2::YFP + unc-119(+)]. VPCs sensitive to RNAi. Vul phenotype from lin-39 RNAi depletion.
NK742 C. elegans rrf-3(pk1426) II; unc-119(ed4) III; rde-1(ne219) V; qyIs139. Show Description
qyIs139 [unc-62p::rde-1(genomic) + myo-2::YFP + unc-119(+)]. VPCs sensitive to RNAi. Vul phenotype from lin-39 RNAi depletion.
XE1057 C. elegans eri-1(mg366) IV; rde-1(ne219) V; lin-15B(n744) X. Show Description
Reference: Firnhaber C & Hammarlund M. PLoS Genet. 2013 Nov;9(11):e1003921.
BB270 C. elegans adr-1(uu49) I; rrf-3(uu56) II; adr-2(uu28) III; rde-1(uu51) V. Show Description
RNAi deficient. Lacks RNA editing. Reference: Reich DP, et al. Genes Dev. 2018 Feb 1;32(3-4):271-282.
XE1474 C. elegans wpSi6 II; eri-1(mg366) IV; rde-1(ne219) V; lin-15B(n744) X. Show Description
wpSi6 [dat-1p::rde-1::SL2::sid-1 + Cbr-unc-119(+)] II. Maintain at 15-20C, sterile at 25C. Superficially wild-type. Dopaminergic neuron-specific RNAi strain. Sensitivity to feeding RNAi is limited to the dopaminergic neurons; all other tissues resistant. Reference: Firnhaber C & Hammarlund M. PLoS Genet. 2013 Nov;9(11):e1003921.
XE1581 C. elegans wpSi10 II; eri-1(mg366) IV; rde-1(ne219) V; lin-15B(n744) X. Show Description
wpSi10 [unc-17p::rde-1::SL2::sid-1 + Cbr-unc-119(+)] II. Maintain at 15-20C, sterile at 25C. Superficially wild-type. Cholinergic neuron-specific RNAi strain. Sensitivity to feeding RNAi is limited to the cholinergic neurons; all other tissues resistant. Reference: Firnhaber C & Hammarlund M. PLoS Genet. 2013 Nov;9(11):e1003921.
XE1582 C. elegans wpSi11 II; eri-1(mg366) IV; rde-1(ne219) V; lin-15B(n744) X. Show Description
wpSi11 [eat-4p::rde-1::SL2::sid-1 + Cbr-unc-119(+)] II. Maintain at 15-20C, sterile at 25C. Superficially wild-type. Glutamatergic neuron-specific RNAi strain. Sensitivity to feeding RNAi is limited to the glutamatergic neurons; all other tissues resistant. Reference: Firnhaber C & Hammarlund M. PLoS Genet. 2013 Nov;9(11):e1003921.
XE1375 C. elegans wpIs36 I; wpSi1 II; eri-1(mg366) IV; rde-1(ne219) V; lin-15B(n744) X. Show Description
wpIs36 [unc-47p::mCherry] I. wpSi1 [unc-47p::rde-1::SL2::sid-1 + Cbr-unc-119(+)] II. Maintain at 15-20C, sterile at 25C. GABAergic neuron-specific RNAi strain. Sensitivity to feeding RNAi is limited to the GABAergic neurons; all other tissues are resistant to RNAi. Superficially wild type with mCherry fluorescence in the GABA motor neurons. Reference: Firnhaber C & Hammarlund M. PLoS Genet. 2013 Nov;9(11):e1003921.
BFF68 C. elegans mjIs134 II; hrde-1(pig6[ha::degron::hrde-1]) III. Show Description
mjIs134 [mex-5p::GFP::(Gly)5Ala/his-58/tbb-2 3?UTR + Cbr-unc-119(+)] II. N-terminal HA-Degron tag inserted into the endogenous hrde-1 locus. gfp fluorescence in germline (mex-5::gfp). Control strain for BFF69; does not carry TIR1 transgene necessary for the degradation. hrde-1(pig6) crRNA sequence: CAUAAUUUUGUCGAGCAAGU. Reference: Toker IA, et al. (2020). Transgenerational Regulation of Sexual Attractiveness in C. elegans Nematodes. bioRxiv.
BFF69 C. elegans mjIs134 II; hrde-1(pig6[ha::degron::hrde-1]) III; ieSi38 IV. Show Description
mjIs134 [mex-5p::GFP::(Gly)5Ala/his-58/tbb-2 3?UTR + Cbr-unc-119(+)] II. ieSi38 [sun-1p::TIR1::mRuby::sun-1 3'UTR + Cbr-unc-119(+)] IV. N-terminal HA-Degron tag inserted into the endogenous hrde-1 locus. Germline-expressed TIR1 and Germline GFP. Allows for the degradation of hrde-1 and heritable RNAi deficiency in the presence of auxin. hrde-1(pig6) crRNA sequence: CAUAAUUUUGUCGAGCAAGU. Reference: Toker IA, et al. (2020). Transgenerational Regulation of Sexual Attractiveness in C. elegans Nematodes. bioRxiv.
SX2499 C. elegans prde-1(mj207) V. Show Description
piRNA biogenesis mutant. Reduced brood size. Maintain at 20C. Reference: Weick EM, et al. Genes Dev. 2014 Apr 1;28(7):783-96.
SX2500 C. elegans prde-1(mj258) V. Show Description
piRNA biogenesis mutant. Reduced brood size. Maintain at 20C. Reference: Weick EM, et al. Genes Dev. 2014 Apr 1;28(7):783-96.
SX2650 C. elegans mjSi74 I. Show Description
mjSi74 [mex-5p::wormCherry::prde-1::par-5] I. Integration into ttTi4348. Reference: Weick EM, et al. Genes Dev. 2014 Apr 1;28(7):783-96.
SX3073 C. elegans mjIs588 II; unc-119(ed3) III Show Description
mjIs588 [mex-5p::GFP::his-58::21UR-1target::tbb-2 3'UTR + unc-119(+)] II. mjIs588 was derived by removing introns 2 and 3 from the construct used to generate the mjIs144 transgene. Single copy inserted into ttTi5605 (MosSCI). Superficially wild-type. mjIs588 GFP is silenced in wild-type animals and de-silenced in hrde-1 mutant animals. Reference: Akay A, et al. Dev Cell. 2017 Aug 7;42(3):241-255.e6.
WM191 C. elegans MAGO12 mutant Show Description
MAGO12 mutant. Full genotype: sago-2(tm894) ppw-1(tm914) ppw-2(tm1120) wago-2(tm2686) wago-1(tm1414) I; wago-11(tm1127) wago-5(tm1113) wago-4(tm1019) II; hrde-1(tm1200) sago-1(tm1195) III; wago-10(tm1186) V; nrde-3(tm1116) X. RNAi resistant. Temperature sensitive. Maintain at 15 C. Reference: Gu, et al. 2009 Mol Cell 36:234-44.
YY160 C. elegans nrde-1(gg88) III. Show Description
eri-1(mg366) has been crossed out of the background. Reference: Burkhart KB, et al. PLoS Genet. 2011 Aug;7(8):e1002249.
YY538 C. elegans hrde-1(tm1200) III. Show Description
Maintain at 15C. Heritable RNAi defective, germline mortality (Mrt) at 25C. Reference: Buckley BA, et al. Nature. 2012 Sep 20;489(7416):447-51.
GR1808 C. elegans rde-10(mg458) I. Show Description
RNAi-defective. Reference: Zhang C, et al. Curr Biol. 2012 May 22;22(10):881-90.
VS26 C. elegans rde-10(hj20) I. Show Description
RNAi defective. Reference: Genes Dev. 2012 Apr 15;26(8):846-56.
VS27 C. elegans rde-11(hj37) IV. Show Description
RNAi defective. Reference: Genes Dev. 2012 Apr 15;26(8):846-56.