Heterozygotes are WT and GFP+. Segregate non-GFP steriles (q145 homozygotes). qIs48 is an insertion of ccEx9747 with markers: myo-2::GFP expressed brightly in the pharynx throughout development, pes-10::GFP expressed in embryos, and a gut promoter driving GFP in the intestine, and is homozygous lethal.

Heterozygotes are WT and segregate WT, Steriles (homozygous ar229), Unc-36 (homozygous eT1), and dead eggs. ar229 have severely reduced germline proliferation.

Heterozygotes are WT and segregate WT, SmaUnc and Steriles. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be used for any commercial purpose or for work on human subjects. eft-3(q145) previously called glp-3(q145).

vbaIs52 [eef-1A.1p::YFP::nrde-3] II. Maintain at 20C or cooler; germline mortal (Mrt) at 25C. YFP::NRDE-3 localizes to the cytoplasm, except in the germline, early embryo, and intestine. Upon introduction of dsRNA, YFP::NRDE-3 labels transcription sites of dsRNA gene targets. Superficially wild-type. Reference: Toudji-Zouaz A, et al. Nucleic Acids Research. 2021 Jun 9;gkab469. doi: 10.1093/nar/gkab469. PMID: 34107044.

vbaIs56 [eef-1A.1p::VenusN::nrde-3] I. vbaIs55 [eef-1A.1p::VenusC::nrde-3] II. Maintain at 20C or cooler; germline mortal (Mrt) at 25C. N-terminal and C-terminal fragments of the fluorescent protein Venus are fused to NRDE-3 to facilitate trimolecular fluorescence complementation. In the cytoplasm or nucleus, local concentration of NRDE-3 molecules does not allow fluorescence complementation, thus reducing background fluorescence; once bound on the target transcript, VenusN::NRDE-3 and VenusC::NRDE-3 are in sufficient proximity to allow for fluorescence complementation, labeling transcription sites of dsRNA gene targets. Superficially wild-type. Reference: Toudji-Zouaz A, et al. Nucleic Acids Research. 2021 Jun 9;gkab469. doi: 10.1093/nar/gkab469. PMID: 34107044.

vbaIs54 [eef-1A.1p::YFP::nrde-3::SL2::sid-1] II. YFP::NRDE-3 localizes to the cytoplasm in most somatic tissues and upon exposure to dsRNA targetting a gene, moves to the nucleus in cells expressing the transgene. Superficially wild-type. Reference: Toudji-Zouaz A, et al. Nucleic Acids Research. 2021 Jun 9;gkab469. doi: 10.1093/nar/gkab469. PMID: 34107044.

Homozygous viable. Deletion of 1624 bp with Calarco/Colaiacovo selection cassette conferring myo-3 GFP and G418 resistance inserted at break. Left flanking sequence: CTCTCAGCCTAAAACATATTTAAGCCTCCC ; Right flanking sequence: GATCATCCGGAAAGGTCACCAAGTCCGCCC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.