More Fields
Strain Species Genotype
GLW39 C. elegans ccdc-47(utx31[mNG::3xFlag::ccdc-47]) III. Show Description
N-terminal tag of CCDC-47 via CRISPR/Cas9 knock-in of mNeonGreen at ccdc-47 locus. Insertion verified by PCR, Sanger sequencing, and fluorescence. Left flank: 5' gttaaatcactcaatttcgggtcgttcacc 3'; Right flank: 5' ATGAAGATAGTATGGATTTTCCTAATATTC 3' (3 silent mutations); sgRNA: cgttcaccATGAAAATCGTC; Cas9/sgRNA plasmid: pGLOW13; mNG^SEC^3xFlag plasmid: pGLOW17; SEC insertion allele strain (balanced): GLW38.
HS304 C. elegans swsn-1(os22) V. Show Description
Temperature sensitive. At 22.5C, maternal effect embryonic lethal. Temperature shift-up to 22.5C during embryogenesis results in animals with Egl, Pvul and Psa (phasmid socket absent) phenotypes. Shift-up to 25C results in growth arrest at larval stage. The T cell division can be symmetric as in lin-17 mutants. At 15C, nearly WT. Males grown at 15C can mate very well. psa-1 encodes a homolog of yeast SW13, a component of the SWI/SNF complex. Sequence data of this strain revealed the mutation is actually GTC/CCC/TCA to GTC/CTC/TCA causing a P86L substitution (G. Hayes).
JR2750 C. elegans bli-6(sc16) unc-22(e66)/unc-24(e138) vha-17(w13) dpy-20(e2017) IV. Show Description
Pick wild type animals to maintain.
OW13 C. elegans grk-1(ok1239) X; pkIs2386 IV. Show Description
pkIs2386 [unc-54p::alpha-synnuclein::YFP + unc-119(+)].
RSL48 C. elegans tni-3(ftw13[tni-3::mCherry::SL2::GFP::NLS]) V. Show Description
Endogenous tni-3 locus tagged with mCherry using CRISPR/Cas9. GFP-nls coexpressed from the endogenous promoter using SL2 trans-splicing. Visible using fluorescent dissecting microscopes. WT movement and behavior. Please contact Ryan Littlefield prior to publishing work using this strain.
RSL49 C. elegans unc-94(ftw3[GFP::unc-94]) I; tni-3(ftw13[tni-3::mCherry::SL2::GFP::NLS]) V. Show Description
GFP tag inserted in endogenous unc-94 locus; specifically tags UNC-94A isoform. mCherry tag inserted into endogenous tni-3 locus; GFP::NLS coexpressed from the endogenous tni-3 promoter via SL2 trans-splicing. GFP::UNC-94 is visible by compound microscopy as striations in body wall muscles, as elongated puncta in single-sarcomere (anal depressor, uterine, and vulval) muscles, as well as the cell bodies of two neurons. GFP::UNC-94 is not visible on fluorescent dissection microscopes. Please contact Ryan Littlefield prior to publishing work using this strain.
BW1341 C. elegans nob-1(ct223) III; eDp6 (III;f). Show Description
Animals with the duplication are WT. Animals without the duplication are Nob (NO Back end; 100% lethal). Pick wild-type to maintain; typically segregates about 50% wild type progeny and 50% Nob larvae.
BW1369 C. elegans unc-32(e189) dpy-18(e364) ctDf2/qC1 [dpy-19(e1259) glp-1(q339)] III. Show Description
Heterozygotes are WT and segregate WT, DpySteriles and dead eggs. Maintain by picking WT.
GLW89 C. elegans ubql-1(utx69[mScarlet-I-C1::3xMyc::ubql-1]) I. Show Description
N-terminal tag of UBQL-1 via CRISPR/Cas9 knock-in of mScarlet at ubql-1 locus. Insertion verified by PCR and fluorescence. Genotyping primers: fwd – 5’ AGGGCGAGAGATTATCGGGA 3’; rev – 5’ CGGATCGTTGAGAATGTGTCC 3’. Left flank: 5' gtcggttttttaatatttctcaaatttaag 3'; Right flank: 5' ATGGCTACAGAGAGTGCACTCATCAAAGTTCACGTGAAATCACCCT 3’ (7 silent mutations); sgRNA: TCAACGTCATACTTGTTCGA; Cas9/sgRNA plasmid: pGLOW134; mScarlet^SEC^3xMyc plasmid: pGLOW145; SEC insertion allele strain: GLW88.
GW1394 C. elegans gwIs39 III; bqSi225 IV; gwIs59. Show Description
gwIs39 [baf-1::gfp-lacI::let-858 3'UTR + vit-5::GFP] III. bqSi225 [emr-1p::emr-1::mCherry + unc-119(+)] IV. gwIs59 [pha-4::mCherry::256xLacO::4xLexA + unc-119(+)]. Superficially wild-type. Express ubiquitous EMR-1::mCherry at the nuclear periphery. Expresses GFP-LacI from early embryogenesis and throughout development, which forms a small spot at the lacO array. Worms have red intestine (all stages) and green intestine (from late L4 stage). Reference: Harr JC, et al. Genes Dev. 2020 Apr 1;34(7-8):560-579. PMID: 32139421.
HW1329 C. elegans lin-41(xe11) I. Show Description
Egg-laying (Egl) defects and subsequent internal hatching of progeny (Bagging) in > 95% of animals. xe11 is a C-to-U point mutation in each of the endogenous let-7 complementary sites, LCS1 and LCS2 [I:C9,335,211T & I:C9,335,260T]. xe11 is a weak gain-of-function allele: mutation of two functionally relevant let-7 binding sites impairs repression by let-7 causing over-expression of LIN-41 in L4 stage animals. Reference: Ecsedi M, et al. Dev Cell. 2015 Feb 9;32(3):335-44. Do not distribute this strain; other labs should request it directly from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
LC144 C. elegans agmo-1(e3016) III. Show Description
General chemical hypersensitivity (including bleach), fragile cuticle. Derived by outcrossing CB7014 five times to N2. [NOTE: the e3016 mutation is TGG>TGA but it affects codon W124, not W130.] Reference: Loer CM, et al. Genetics. 2015 May;200(1):237-53.
NW1313 C. elegans mig-6(ev700) V. Show Description
Abnormal distal tip cell migration detectable as clear patches in anterior and posterior. Partially penetrant embryonic arrest and early larval lethal.
NW1314 C. elegans mig-6(ev701) V. Show Description
Abnormal distal tip cell migration detectable as clear patches in anterior and posterior. Partially penetrant embryonic arrest and early larval lethal.
RW130 C. elegans unc-54(st130) I. Show Description
Dominant suppressor of unc-22(s12). See WBG 9(1):22 and WBG 9(2):18 and C. elegans II page 427.
RW132 C. elegans unc-54(st132) I. Show Description
Dominant suppressor of unc-22(s12). See WBG 9(1):22 and WBG 9(2):18 and C. elegans II page 427. [Jan 2007: Taylor Allen suggests that st132 may have a temperature sensitive phenotype.]
RW1324 C. elegans fem-1(e1991) unc-24(e138) unc-22(s12)/stDf7 IV. Show Description
Heterozygotes have Unc-24 phenotype and segregate additional hets, embryonic lethals (stDf7/stDf7) and Unc females (or sometimes hermaphrodites) that Twitch.
RW1329 C. elegans pat-12(st430)/unc-45(e286) III. Show Description
At 20C heterozygotes are WT and segregate WT, Uncs and PATs. st430 is a recessive lethal causing "mild" PAT phenotype. unc-45 is temperature sensitive (WT at 15C).
RW1333 C. elegans fem-1(e1991) unc-24(e138) unc-22(s12)/stDf8 IV. Show Description
Heterozygotes have Unc-24 phenotype and segregate additional hets, embryonic lethals (stDf8/stDf8) and Unc females (or sometimes hermaphrodites) that Twitch.
RW134 C. elegans unc-54(st134) I. Show Description
Dominant suppressor of unc-22(s12). See WBG 9(1):22 and WBG 9(2):18 and C. elegans II page 427.
RW135 C. elegans unc-54(st135) I. Show Description
Dominant suppressor of unc-22(s12). See WBG 9(1):22 and WBG 9(2):18 and C. elegans II page 427.
RW1350 C. elegans unc-44(e362) unc-82(e1323)/stDf7 IV. Show Description
Segregates heterozygotes that display only the unc-82 phenotype: slow but normal movement, disorganized muscle structure, somewhat Egl. stDf7 homozygotes die as embyros. unc-44 unc-82 homozygotes generally die as coiled, poorly-moving larvae.
RW1383 C. elegans unc-38(x20) pat-10(st568)/unc-38(x20) dpy-5(e61) I. Show Description
Heterozygotes are Unc non-Dpy and segregate Unc non-Dpy, DpyUnc and PATs. st568 is a recessive lethal causing a PAT phenotype (paralyzed embryoes, arrested elongation at 2-fold length).
RW1385 C. elegans mnDp1 (X;V)/+ V; unc-3(e151) pat-9(st558) X. Show Description
Animals with the duplication are WT and segregate WT, sterile and Pats. Strain can be propagated by chunking.
SBW136 C. elegans baf-1(sbw7[mNeonGreen::baf-1]) III. Show Description
mNeonGreen tag inserted at N-terminus of endogenous baf-1 locus using self-excising drug selection cassette method (described by Dickinson, et al. 2015, Genetics). Reference: Barger SR, et al. J Cell Sci 1 November 2023; 136 (21): jcs261385. doi: https://doi.org/10.1242/jcs.261385. PMID: 37795681.
XW13734 C. elegans unc-76(e911) V; qxIs612. Show Description
qxIs612 [hsp-16.2p::nuc-1::sfGFP::mCherry::unc-54 3'UTR + hsp-16.41p::nuc-1::sfGFP::mCherry::unc-54 3'UTR + unc-76(+)]. Heat-shock inducible NUC-1::sfGFP::mCherry fusion transgene for monitoring lysosomal activity. Array contains p76-16B, a plasmid containing 10.5 kb genomic DNA including unc-76. Reference: Miao R, et al. Dev Cell. 2020 Jan 6;52(1):21-37.e5. doi: 10.1016/j.devcel.2019.10.020. PMID: 31735670.