More Fields
Strain Species Genotype
BW1084 C. elegans ncl-1(e1865) unc-36(e251) tra-1(e1099) dpy-18(e364) III; ctDp6 (III;f). Show Description
Animals which carry ctDp6 are WT. Animals which have lost ctDp6 are DpyUnc Males. Maintain by picking WT.
BW2041 C. elegans pal-1(ct224) dpy-17(e164) ncl-1(e1865) unc-36(e251) III; svDp1 (III;f). Show Description
svDp1 [sur-5::GFP] (III;f). svDp1 was derived by insertion of a sur-5::GFP marker into sDp3(III;f). Pick GFP+ wild-type to maintain. svDp1 rescues ct224. ct224 homozygotes (lacking GFP expression) show Nob phenotype: approximately 80% of homozygous embryos arrest at about the time of hatching with fairly normal anterior development but a severely deformed posterior with a variable knob-like shape; approximately 20% fail to enclose and do not hatch. The duplication is lost in about 30-40% of embryos. Reference: Edgar LG, et al. Dev Biol. 2001 Jan 1;229(1):71-88.
BW2063 C. elegans ceh-20(ay38) unc-36(e251) III; svDp1 (III;f). Show Description
May have unc-4(e120) mutation in background. svDp1 balances from pal-1 through unc-36 on III. svDp1 made by fusing array containing [unc-4(+) + sur-5::GFP] to sDp3(III;f).
CB251 C. elegans unc-36(e251) III. Show Description
Unc. Recessive. M-MATING-NO SUCCESS.
CGC26 C. elegans dpy-5(e61)/hT2 [umnIs15] I; unc-36(e251)/hT2 [bli-4(e937) let-?(h661)] III. Show Description
umnIs15 [myo-2p::GFP + NeoR, III: 9421936 (intergenic)] I. Heterozygotes are WT GFP+ and segregate WT GFP+, DpyUnc, lethal GFP+ hT2 homozygotes (arrest stage unknown) and dead eggs (aneuploids). Will throw an occasional GFP+ Dpy non-Unc (similar events were observed in the parental hT2 strain). Pick WT GFP+ and check for correct segregation of progeny to maintain. Derived by insertion of myo-2p::GFP transgene into hT2 balancer in parental strain KR2467 using CRISPR/Cas9. [NOTE: 3/1995: Apparently the lethal mutation is closely linked but not within the balanced region of hT2. It can occasionally recombine away so that the strain will segregate Bli-4 hT2 homozygotes. (Mark Edgley)]
CGC52 C. elegans dpy-5(e61)/hT2 I; unc-36(e251)/hT2 [bli-4(e937) let-?(h661) umnIs42] III. Show Description
umnIs42 [myo-2p::mKate2 + NeoR, I: 6284001 (intergenic)] III. Heterozygotes are WT mKate2+ and segregate WT mKate2+, DpyUnc, lethal mKate2+ hT2 homozygotes (arrest stage unknown) and dead eggs (aneuploids). Will throw an occasional mKate2+ Dpy non-Unc (similar events were observed in the parental hT2 strain). Pick WT mKate2+ and check for correct segregation of progeny to maintain. Derived by insertion of myo-2p::mKate2 transgene into hT2 balancer in parental strain KR2467 using CRISPR/Cas9. [NOTE: 3/1995: Apparently the lethal mutation is closely linked but not within the balanced region of hT2. It can occasionally recombine away so that the strain will segregate Bli-4 hT2 homozygotes. (Mark Edgley)]
CGC86 C. elegans dpy-5(e61)/hT2 I; unc-36(e251)/hT2 [bli-4(e937) let-?(h661) umnIs67] III. Show Description
umnIs67 [myo-2p::GFP + NeoR, I: 6284001 (intergenic)] III. Heterozygotes are WT GFP+ and segregate WT GFP+, DpyUnc, lethal GFP+ hT2 homozygotes (arrest stage unknown) and dead eggs (aneuploids). Will throw an occasional GFP+ Dpy non-Unc (similar events were observed in the parental hT2 strain). Pick WT GFP+ and check for correct segregation of progeny to maintain. Derived by insertion of myo-2p::GFP transgene into hT2 balancer in parental strain KR2467 using CRISPR/Cas9. [NOTE: 3/1995: Apparently the lethal mutation is closely linked but not within the balanced region of hT2. It can occasionally recombine away so that the strain will segregate Bli-4 hT2 homozygotes. (Mark Edgley)]
CGC92 C.elegans dpy-5(e61)/hT2 [umnIs73] I; unc-36(e251)/hT2 [bli-4(e937) let-?(h661)] III. Show Description
umnIs73 [myo-2p::mKate2 + NeoR, III: 9421936 (intergenic)] I. Heterozygotes are WT mKate2+ and segregate WT mKate2+, DpyUnc, lethal mKate2+ hT2 homozygotes (arrest stage unknown) and dead eggs (aneuploids). Will throw an occasional mKate+ Dpy non-Unc (similar events were observed in the parental hT2 strain). Pick WT mKate2+ and check for correct segregation of progeny to maintain. Derived by insertion of myo-2p::mKate2 transgene into hT2 balancer in parental strain KR2467 using CRISPR/Cas9. [NOTE: 3/1995: Apparently the lethal mutation is closely linked but not within the balanced region of hT2. It can occasionally recombine away so that the strain will segregate Bli-4 hT2 homozygotes. (Mark Edgley)]
CH1179 C. elegans unc-36(e251) emb-9(g23cg46)/qC1 [dpy-19(e1259) glp-1(q339)] III. Show Description
Heterozygotes are WT and segregate WT, Dpy Steriles and 3-fold lethals. cg46 is a 497 bp deletion that removes the last 22 nucleotides of intron 9 and 475 nucleotides of exon 10;
DA939 C. elegans unc-36(e251) III; egl-19(n2368) IV. Show Description
Unc. Semidominant Egl-c, Sma.
DA944 C. elegans unc-36(e251) III; egl-19(ad695) IV. Show Description
Unc. Semidominant Eat (TB relaxation defective).
DA945 C. elegans unc-36(e251) III; egl-19(n582) IV. Show Description
Unc. Semidominant Egl, Lon, Slow and Floppy
DG695 C. elegans +/hT2 [dpy-18(h662)] I; unc-36(e251) evl-8(ar102)/hT2 [bli-4(e937)] III. Show Description
Heterozygotes are WT and segregate WT, Uncs with an everted Vulva, Dpys and dead eggs.
DG696 C. elegans +/hT2 [dpy-18(h662)] I; unc-36(e251) evl-19(ar98)/hT2 [bli-4(e937)] III. Show Description
Heterozygotes are WT and segregate WT, Uncs with an everted Vulva, Dpys and dead eggs.
DG815 C. elegans unc-32(e189) emb-30(tn475)/unc-36(e251) III. Show Description
Heterozygotes are WT and segregate WT, Unc-32 Steriles and Unc-36.
DR1096 C. elegans lon-1(e185) unc-36(e251) III. Show Description
Very long, thin, and slow moving.
EU396 C. elegans cyk-1(or36) unc-36(e251)/qC1 [dpy-19(e1259) glp-1(q339)] III. Show Description
Heterozygotes are WT and segregate WT, Sterile Dpys and Uncs which give only dead eggs.
EU415 C. elegans cyk-1(or36) unc-36(e251)/qC1 [dpy-19(e1259) glp-1(q339)] III; him-8(e1489) IV. Show Description
Heterozygotes are WT and segregate WT, Sterile Dpys and Uncs which give only dead eggs at all temperatures. Throws males.
GS195 C. elegans ncl-1(e1865) unc-36(e251) glp-1(q46) mua-3(ar62) III; qDp3 (III;f). Show Description
Animals with the duplication are WT and segregate WT and larval lethals. Larval muscle dettachment and arrest at about L1 stage in mua-3(ar62) homozygotes. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
GS234 C. elegans mup-4(ar60) ncl-1(e1865) unc-36(e251) glp-1(q46) III; qDp3 (III;f). Show Description
Animals with the duplication are WT and segregate WT and dead eggs. 3-fold muscle dettachment and arrest in 90% of mup-4(ar60) homozygotes; 10% arrest earlier. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
GS311 C. elegans unc-36(e251) evl-14(ar97)/dpy-17(e164) unc-32(e189) III. Show Description
Heterozygotes are WT and segregate WT, DpyUncs and Sterile Unc-36 which have an everted vulva. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
GS316 C. elegans unc-36(e251) evl-14(ar96)/dpy-17(e164) unc-32(e189) III. Show Description
Heterozygotes are WT and segregate WT, DpyUncs and Sterile Unc-36 which have an everted vulva. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
GS320 C. elegans unc-36(e251) evl-8(ar102)/dpy-17(e164) unc-32(e189) III. Show Description
Heterozygotes are WT and segregate WT, DpyUncs and Unc Steriles which have an everted vulva. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
GS328 C. elegans unc-36(e251) evl-19(ar98)/dpy-17(e164) unc-32(e189) III. Show Description
Heterozygotes are WT and segregate WT, DpyUncs and Sterile Unc-36 which have an everted vulva. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
GS387 C. elegans unc-36(e251) evl-14(ar112)/dpy-17(e164) unc-32(e189) III. Show Description
Heterozygotes are WT and segregate WT, DpyUncs and Sterile Unc-36 which have an everted vulva. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
GS422 C. elegans evl-21(ar122) unc-36(e251)/unc-93(e1500) dpy-17(e164) III. Show Description
Heterozygotes are WT and segregate WT, DpyUncs and Sterile Unc-36 which have an everted vulva. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
GS457 C. elegans evl-18(ar117) dpy-17(e164)/unc-36(e251) III. Show Description
Heterozygotes are WT and segregate WT, Uncs and Sterile Dpys which have an everted vulva. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
JK1774 C. elegans eef-1A.1(q145)/sma-3(e491) unc-36(e251) III. Show Description
Heterozygotes are WT and segregate WT, SmaUnc and Steriles. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be used for any commercial purpose or for work on human subjects. eft-3(q145) previously called glp-3(q145).
JK867 C. elegans dpy-17(e164) ncl-1(e1865) unc-36(e251) III; qDp3 (III;f). Show Description
Animals which have the Duplication are Dpy. Animals which have lost the Duplication are DpyUncNcl. qDp3 homozygotes are lethal. Maintain by picking Dpy non-Unc. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
KK204 C. elegans sma-4(e729) mab-5(e1239) unc-36(e251) III. Show Description
Small and Unc.
KR2467 C. elegans dpy-5(e61)/hT2 I; unc-36(e251)/hT2 [bli-4(e937) let-?(h661)] III. Show Description
Heterozygotes are WT and segregate WT, DpyUnc, lethal hT2 homozygotes (arrest stage unknown) and dead eggs (aneuploids). Maintain by picking WT. [March 1995: Apparently the lethal mutation is not in the balanced region. It occasionally crosses off and the strain starts giving Bli-4 hT2 homozygotes again. From Mark Edgley.] This strain was generated by the Genetic Toolkit project, which should be acknowledged in any publications resulting from its use: The Genetic Toolkit is funded by the NIH National Center for Research Resources (NCRR) (USA) to Ann M. Rose, David L. Baillie, and Donald L. Riddle. Report all experimental results to Ann Rose.
MS231 C. elegans dpy-17(e164) ncl-1(e1865) unc-36(e251) III; irDp1 (III;f). Show Description
Superficially WT. Pick WT to propagate. Throws WT (expressing unc-119::YFP) and DpyUncs. irDp1 is sDp3 carrying a spontaneous integrant of an array carrying unc-119::YFP + unc-32(+) + med-1(+), originally generated in BC4638. irDp1 appears to complement everything sDp3 does and has a similar meiotic transmission frequency of 60%. In another strain, irDp2 was observed to lose ability to complement dpy-17. irDp1 confers a progressive adult egg laying defect (also seen with sDp3).
MT1978 C. elegans nDf16/unc-36(e251) dpy-19(e1259) III. Show Description
Heterozygotes are Unc and segregate Unc, DpyUnc (Dpy is ts) and dead eggs. Maintain by picking Uncs.
MT2867 C. elegans unc-36(e251) III; unc-5(e53) IV; dpy-11(e224) V; lon-2(e678) lin-15B&lin-15A(n765) X. Show Description
MT3025 C. elegans let-23(n1045) II; lin-13(n387) unc-36(e251)/unc-32(e189) III. Show Description
Heterozygotes are Vulvaless and segregate more Vul, Vul Unc-36 and Vul Unc-32. n1045 is cold sensitive-strain gives some arrested larvae (L2) which look like little sticks.
MT3026 C. elegans lin-8(n111) II; sma-3(e491) lin-37(n758) unc-36(e251) III. Show Description
Small. Unc. Muv.
MT3040 C. elegans lin-8(n111) II; sma-3(e491) unc-36(e251) III. Show Description
SmaUnc. Not Muv.
MT3061 C. elegans lin-8(n111) II; sma-3(e491) lin-13(n387) unc-36(e251)/sma-3(e491) lin-37(n758) III. Show Description
Heterozygotes are Sma. At 25C, hets segregate Sma, SmaMuv (lin-8; sma-3 lin-37), and SmaUncMuvSte (lin-8; sma-3 lin-13 unc-36). At 15C, hets segregate Sma, SmaMuv (lin-8; sma-3 lin-37) and SmaUnc which give sterile F2 (lin-8; sma-3 lin-13 unc-36). n387 is a ts maternal effect mutation.
MT4306 C. elegans lin-39(n1490) unc-36(e251) III. Show Description
Unc. Vulvaless (temperature sensitive-91% Vul at 15C and 100% Vul at 20C and 25C). n1490 is also temperature sensitive Unc.
MT5277 C. elegans dpy-17(e164) unc-36(e251) III. Show Description
DpyUnc.
MT5828 C. elegans lin-36(n766) unc-36(e251) III; lin-15A(n767) X. Show Description
Unc. Muv.
MT7594 C. elegans lin-39(n1760) ncl-1(e1865) unc-36(e251) III; sDp3 (III;f). Show Description
Pick WT to maintain strain. Dp lost at high frequency, usable for mosaic analysis. Animals without the Dp are Unc, Vul and Ncl.
MT9454 C. elegans cup-5(n3194) unc-36(e251)/qC1 [dpy-19(e1259) glp-1(q339)] III. Show Description
Heterozygotes are WT and segregate WT, Sterile Dpys, and Mel Uncs. cup-5(n3194) is a Q139 ochre allele with a maternal effect lethal phenotype including accumulation of refractile bodies resembling apoptotic cells in some regards. cup-5 homozygotes are also defective in coelomocyte uptake.
MT9830 C. elegans unc-36(e251) III; dpy-20(e1282) IV; lin-15B&lin-15A(n765) X. Show Description
NH2296 C. elegans ceh-20(ay42) unc-36(e251)/sma-3(e491) unc-36(e251) III. Show Description
Heterozygotes are Unc and segregate Unc, SmaUnc and UncVul. ay42 is a strong Vul and is recessive. ay42 has slow growth.
NH2552 C. elegans ceh-20(ay38) unc-36(e251)/sma-3(e491) unc-36(e251) III. Show Description
Heterozygotes are Unc and segregate Unc, SmaUnc and larval lethals. Putative null allele.
PB49 C. elegans egl-5(n486) unc-36(e251) III; him-5(e1490) V. Show Description
Unc and Egl. Throws males.
RG3239 C. elegans ZK858.7(ve739[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/hT2 [umnIs73] I; unc-36(e251)/hT2 [bli-4(e937) let-?(h661)] III. Show Description
umnIs73 [myo-2p::mKate2 + NeoR, III: 9421936 (intergenic)] I. Homozygous lethal. Deletion of 2453 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate2 lethals(lethal mid-larval to adult) (ve739 homozygotes), non-GFP mKate2+ arrested animals (arrest stage unknown)(hT2 homozygotes) and dead eggs (aneuploids). Pick wild-type GFP+ mKate2+ and check for correct segregation of progeny to maintain. [NOTE: Apparently the lethal mutation in hT2 is closely linked but not within the balanced region of hT2. It can occasionally recombine away so that the strain will segregate Bli-4 hT2 homozygotes. (Mark Edgley)] Left flanking Sequence: catattattaaattttaagtgtaaaagatt ; Right flanking sequence: aggcaacagagaacgaacgataaagtagtc. sgRNA #1: gaggaaatatgcaatttact; sgRNA #2: atcgacgagacggctacgaa. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
SP1696 C. elegans him-10(e1511) ncl-1(e1865) unc-36(e251) III. Show Description
Unc strain. Throws males (ts).
SP1697 C. elegans dpy-1(e1) ncl-1(e1865) unc-36(e251) III; mnDp84 (III;f). Show Description
Animals with the duplication are WT. Animals which have lost the duplications are DpyUncNcl. Maintain by picking WT. Males containing mnDp84 are not fertile.