Strain Information
| Name | JN2722 View On Wormbase |
|---|---|
| Species | C. elegans |
| Genotype | daf-2(pe2722) III. |
| Description | daf-2(pe2722) is a daf-2c-isoform specific mutation. pe2722 is a CRISPR/Cas9-engineered 41 bp deletion (ggttgatgacgatgatgagcccggcggcaggaggcagtgagcaaca) in daf-2 exon 11.5. Guide RNA sequence: gacgatgaagagcccggcgg. Reference: Nagashima T, et al. PLoS Genet. 2019 Jul 19;15(7):e1008297. PMID: 31323047 |
| Mutagen | No mutagen |
| Outcrossed | x0 |
| Made by | Tomioka M. |
| Laboratory | JN |
| Reference | DAF-16/FOXO promotes taste avoidance learning independently of axonal insulin-like signaling. Nagashima, T., Iino, Y., and Tomioka, M. PLoS Genet 15, e1008297. 10.1371/journal.pgen.1008297. |
Sign in
or
register an account if you want to order this strain.