Search Strains

989bp deletion. Primers used: RB1537 (external left): CAAGCTTAATTTGCACACAATGCGTCAG; RB1540 (external right): AGAAGAGGCAAGAATGGAACTTGTGCG; RB1538 (internal left): AACAATTTCCGCTTATTTTCAGCGTTTG; RB1539 (internal right): CTGAACCATTGAAAGCTTTTCAGATC. Deletion breakpoints (T09B4 coordinates): 32756/33746 through 32757/33747.

Viable, Bus, resistant to Leucobacter Verde2, hypersensitive to Leucobacter Verde1. e2715 is a small deficiency (3191 bp) which removes all of the bus-10 exons and internal ncRNA genes ZK596.4 & ZK596.5. Reference: O'Rourke et al (in preparation).

Viable, Bus (M. nematophilum resistant), resistant to Leucobacter Verde2, hypersensitive to Leucobacter Verde1. e2737 is a ~4.5 kb deficiency which removes all of the bus-10 exons, internal ncRNA genes ZK596.4 & ZK596.5, and ZK596.1. Reference: O'Rourke et al (in preparation).

Bus, bleach-sensitive, resistant to Leucobacter Verde2 and Leucobacter Verde1. e2715 is a small deficiency (3191 bp) which removes all of the bus-10 exons and internal ncRNA genes ZK596.4 & ZK596.5. Reference: O'Rourke et al (in preparation).

C07H6.5. Homozygous sterile deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok492 homozygotes (sterile adult, tends to explode at vulva). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: GGCAGCTCGAAAATATTGCC. External right primer: GGAAAACCGCAAGGATGGTGG. Internal left primer: TCACGGAGCTAGATGTGACG. Internal right primer: CGTCAAAAAGAACCCGATGT. Internal WT amplicon: 3095 bp. Deletion size: 1043 bp. Deletion left flank: GAGAACATACACAATCTGGACGAGATCACT. Deletion right flank: CCTGGGGTGGCGATGACCAAGTGAACCGTT. This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. URL: http://www.celeganskoconsortium.omrf.org.

M01G12.12. External left primer: GAGTGGTGGGCAATTGAGTT. External right primer: CCACCCAAGATCTGGTCAGT. Internal left primer: TGTCAACTTGAGGATCGACG. Internal right primer: ATTCCTGCAATTGGTCAAGG. Internal WT amplicon: 2509 bp. Deletion size: 979 bp. Deletion left flank: ATTTTCAACGAAAGTTTTTCGGTTATTTCA. Deletion right flank: AGAGGAAAAAATACGGACAAGAAGAATAAT.

pup-4/F43E2.1. Maintain at 15-20C. Homozygotes produce <1% sterile individuals at 25C after multiple generations. ~10% of fertile individuals contain one infertile gonad arm. om140 is a CRISPR-engineered internal deletion removing most of the pup-4 coding sequence. Reference: Kelley L, et al. Development. 2024 Oct 7;228(2):iyae120. doi: 10.1093/genetics/iyae120. PMID: 39067069.

H01G02.2. External left primer: TGCATCCCTTTGATTCCTTC. External right primer: AAACCTGGGCGCTTTTATTT. Internal left primer: GCAATCCTTGCTTGATCCAT. Internal right primer: TGATTGCAACGTTCCATGAT. Internal WT amplicon: 3033 bp. Deletion size: 1251 bp. Deletion left flank: AAACTCACTTTTGAAACATTCGGGACCATT. Deletion right flank: GATGAAGATCATGGAACGTTGCAATCAATT. This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. URL: http://www.celeganskoconsortium.omrf.org.

Internal tag of EGL-19 at N-terminal side of exon 3 via CRISPR/Cas9 knock-in of mScarlet at egl-19 locus. Tags isoforms a and b. Insertion verified by PCR and fluorescence. Left flank: 5' ttatttgaatgagcaaaaaataaatttcag 3'; Right flank: 5' GCCGCAGTGGCAGCTTCATCATCACAAGAT 3’ (1 silent mutation); gRNA: TTGTGATGATGAAGCTGCCA; Cas9/sgRNA plasmid: pGLOW69; mScarlet^SEC^3xMyc plasmid: pGLOW60; SEC insertion allele strain (balanced): GLW52.

Egg-laying (Egl) defects and subsequent internal hatching of progeny (Bagging) in > 95% of animals. xe11 is a C-to-U point mutation in each of the endogenous let-7 complementary sites, LCS1 and LCS2 [I:C9,335,211T & I:C9,335,260T]. xe11 is a weak gain-of-function allele: mutation of two functionally relevant let-7 binding sites impairs repression by let-7 causing over-expression of LIN-41 in L4 stage animals. Reference: Ecsedi M, et al. Dev Cell. 2015 Feb 9;32(3):335-44. Do not distribute this strain; other labs should request it directly from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.

Internal mNeonGreen::3xFLAG tags inserted into endogenous spia-1 locus.

Internal mNeonGreen::3xFLAG tags with linker sequences inserted into endogenous bli-1 locus. Superficially wild-type. Reference: Johnson LC, et al. Development 2023; dev.201085. doi: https://doi.org/10.1242/dev.201085.

Internal mNeonGreen(dpiRNA)::3xFLAG tags with linker sequences inserted into endogenous noah-1 locus. mNeonGreen(dpiRNA) is optimized to remove all piRNA sites. Superficially wild-type. Reference: Johnson LC, et al. Development 2023; dev.201085. doi: https://doi.org/10.1242/dev.201085.

Modular linker::mNeonGreen::3xFLAG::linker tag inserted internally in exon 2 of the endogenous col-10 locus by CRISPR which will produce a translational fusion after amino acid 89. Allele obtained using Cas9 RNP. Cassette design allows for re-editing of locus with common crRNAs/sgRNAs.

Superficially wild type. Modular linker::mNeonGreen::3xFLAG::linker tag inserted in the endogenous col-97 locus by CRISPR to produce a translational fusion inserted internally near the C-terminus (after amino acid 288). Allele obtained using plasmid-based unc-119 selection. Injection of a Cre recombinase plasmid failed to excise the loxP-flanked unc-119(+) cassette for unknown reasons. The insert was verified to be correct through Sanger sequencing. Knock-in is linked to the temperature-sensitive unc-119(kst33) allele. Cassette design allows for re-editing of locus with common crRNAs/sgRNAs.

Modular linker::mNeonGreen::3xFLAG::linker tag inserted internally in exon 1 in the endogenous col-75 locus by CRISPR; produces a translation fusion after amino acid 18, immediately following the signal peptide.. Allele obtained using plasmid-based unc-119 selection in a temperature-sensitive unc-119(kst33) III background The unc-119(+) cassette was removed through Cre-mediated excision and the unc-119(kst33) allele was removed by outcrossing. Cassette design allows for re-editing of locus with common crRNAs/sgRNAs.

Superficially wild type. Linker::mScarlet::2xOLLAS::linker inserted internally, to produce a translational fusion 11 amino away from the C-terminus of the endogenous cpz-1 locus by CRISPR using a Cas9 RNP. Allele obtained by replacing a modular mNeonGreen::3xFLAG cassette from wrd128.

T05C12.6, T05C12.7. Heterozygotes are WT and GFP+ in the pharynx. mIn1[mIs14 dpy-10(e128)] homozygotes are Dpy and GFP+ in the pharynx. Homozygous mig-5&cct-1(ok280) worms arrest at about L2/L3. Strong loss of function for cct-1 and weak for mig-5. mig-5 is a dishelved homologue. External left primer: CGGCCTAAACGTTGATTGTT. External right primer: CAGAGTGAGTCGTGAACCGA. Internal left primer: TAATCCTGAATCCGGACGAG. Internal right primer: TACGAGATTTCGGTCCCTTG. Internal WT amplicon: 3284 bp. Deletion size: 987 bp. Deletion left flank: GCTGCAGTCTGATGTGCATGGCGGCTCCAT. Deletion right flank: TTGGTGTTGTCTATGCTTCAAGAAAATTGA. Do not distribute this strain; other labs should request it from the CGC.

B0273.2. External left primer: AAGCATACAGGCGCAGAGAT. External right primer: TACCGTATTGTGGTGCGAAA. Internal left primer: AACGGTTGCTCATCTGACTT. Internal right primer: AAAATTGCGTCGATTTTTGG. Internal WT amplicon: 2701 bp. Deletion size: 1751 bp. Deletion left flank: TTAAAACTTCTAATTTAAATAAAAAATATA. Deletion right flank: TATGTCGTTCAGCAAATGATTTCGATTTGC. Do not distribute this strain; other labs should request it from the CGC.

Internal 3xMyc tag inserted into endogenous cya-1 locus.

Internal 3xMyc tag inserted into endogenous cyb-3 locus.

Internal 3xMyc tag inserted into endogenous cyd-1 locus.

qSi380 [mex-5p::eGFP::3xOLASS::linker::his-58::MODC pest::3xboxb::tbb-2 3'UTR::SL2 trans-splice site::mCherry::3xV5::linker::his-58::MODC pest::mutant 3xboxb::tbb-2 3'utr::tbb-1 intergenic region] IV. Worms are fertile at 20C. Improved tethering assay for use in the C. elegans germline. GFP reporter mRNA is under control of a germline-expressed mex-5 promoter and has three boxB stem-loops in its 3'UTR. The RNA-binding protein (RBP) is tagged with lamda-N. The nascent transcript driven by mex-5 promoter is resolved by trans-splicing into two mRNAs that encode distinct reporters. The GFP reporter RNA has three functional boxB stem-loops in its 3'UTR; the mCherry reporter 3'UTR has three mutated boxB stem-loops that do not bind lamda-N and therefore provides an internal control. Addition of an OLLAS tag to GFP and a V5 tag to mCherry enables sensitive immunostaining and immunoblotting. Reference: Doenier J, et al. RNA. 2021 Jun;(6)643-652. PMID: 33727224.

qSi380 [mex-5p::eGFP::3xOLASS::linker::his-58::MODC pest::3xboxb::tbb-2 3’utr::SL2 trans-splice site::mCherry::3xV5::linker::his-58::MODC pest::mutant 3xboxb::tbb-2 3'utr::tbb-1 intergenic region] IV. Worms are fertile at 20C. Improved tethering assay for use in the C. elegans germline. GFP reporter mRNA is under control of a germline-expressed mex-5 promoter and has three boxB stem–loops in its 3?UTR. The RNA-binding protein (RBP) is tagged with lamda-N. The nascent transcript driven by mex-5 promoter is resolved by trans-splicing into two mRNAs that encode distinct reporters. The gfp reporter RNA has three functional boxB stem–loops in its 3?UTR; the mCherry reporter 3?UTR has three mutated boxB stem–loops that do not bind lamda-N and therefore provides an internal control. Addition of an OLLAS tag to GFP and a V5 tag to mCherry enables sensitive immunostaining and immunoblotting. Reference: Doenier J, et al. RNA. 2021 Jun;(6)643-652. PMID: 33727224.

243 bp internal deletion.

syb8406 is WrmScarlet and 3xFlag tags inserted into endogenous tol-1 locus. syb8408 is internal eGFP and FLAG tags with poly-A linkers inserted into endogenous lat-1 locus before 651 aa. Reference: Carmona-Rosas G, et al. bioRxiv 2023.05.04.539414; doi: https://doi.org/10.1101/2023.05.04.539414.

T21C9.2, F32G8.6. Serotonin-deficient by anti-serotonin staining. Bleach hypersensitive. Likely also dopamine-deficient (but not tested). Slightly sickly. External left primer: TTTCTTTTCTTGTTGCGCCT. External right primer: TCGAAAAAGTCTGCTTCGGT. Internal left primer: CGTCTTCCGTTTCTTTTTCG. Internal right primer: TCTTGGAATGTGGGATGTGA. Internal WT amplicon: 2497 bp. Deletion size: 2238 bp. Deletion left flank: CGACTAGATTGATTTCCTTCTGTCCCTTCA. Deletion right flank: CTTGACGGAACAACGCCTCGATCTGATCTC. This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. URL: http://www.celeganskoconsortium.omrf.org.

mRuby2G tag inserted into the endogenous emb-9 locus (internal tag). Reference: Jayadev R, et al. Sci Adv. 2022 May 20;8(20):eabn2265. doi: 10.1126/sciadv.abn2265. PMID: 35584218.

CRISPR/Cas9 insertion of mRuby2G into the endogenous emb-9 locus (internal tag) in an RNAi-sensitized background. Reference: Gianakas CA, et al. J Cell Biol. 2023 Jan 2;222(1):e202112096. doi: 10.1083/jcb.202112096. PMID: 36282214.

mNG tag inserted into the endogenous fbn-1 locus. Reference: Jayadev R, et al. Sci Adv. 2022 May 20;8(20):eabn2265. doi: 10.1126/sciadv.abn2265. PMID: 35584218.

mNG tag inserted into the endogenous sax-3 locus (internal tag). Reference: Jayadev R, et al. Sci Adv. 2022 May 20;8(20):eabn2265. doi: 10.1126/sciadv.abn2265. PMID: 35584218.

mNG tag inserted into the endogenous eva-1 locus (internal tag). Reference: Jayadev R, et al. Sci Adv. 2022 May 20;8(20):eabn2265. doi: 10.1126/sciadv.abn2265. PMID: 35584218.

mNG tag inserted into the endogenous col-99 locus (internal tag). Reference: Jayadev R, et al. Sci Adv. 2022 May 20;8(20):eabn2265. doi: 10.1126/sciadv.abn2265. PMID: 35584218.

mNG tag inserted into the endogenous T19D12.6 locus (internal tag). Reference: Jayadev R, et al. Sci Adv. 2022 May 20;8(20):eabn2265. doi: 10.1126/sciadv.abn2265. PMID: 35584218.

mNG tag inserted into the endogenous adm-4 locus (internal tag). Reference: Jayadev R, et al. Sci Adv. 2022 May 20;8(20):eabn2265. doi: 10.1126/sciadv.abn2265. PMID: 35584218.

Superfically wild-type strain with ubiquitous somatic expression of ATP biosensor iATPSnFR1.0 inserted into ttTi4348 mosSCI site (I:-5.32) using CRISPR/Cas9-mediated recombination. Internal iATPSnFR1.0 reverse primer: 5' CTTCATCTCGGCGACGGAGAGACGGTT 3'

CRISPR/Cas9 insertion of mNeonGreen into the endogenous gon-1 locus and mRuby2G tag inserted into the endogenous emb-9 locus (internal tag). Reference: Gianakas CA, et al. J Cell Biol. 2023 Jan 2;222(1):e202112096. doi: 10.1083/jcb.202112096. PMID: 36282214.

qySi275 [nduv-2p::mNG::P2A::mKate2::unc-54 3'UTR] I. nduv-2 transcriptional reporter fused to mNeonGreen and mKate2. Inserted into ttTi4348 mosSCI site (I:-5.32) using CRISPR/Cas9-mediated recombination. Internal mKate2 reverse primer: 5' CCTTGATTCTCATGGTCTGAG 3'. Superfically wild-type.

qySi316 [nuo-1p::mNG::P2A::mKate2::unc-54 3'UTR] I. Transcriptional nuo-1 reporter fused to mNeonGreen and mKate2 inserted into ttTi4348 mosSCI site (I:-5.32) using CRISPR/Cas9-mediated recombination. Internal mKate2 reverse primer: 5' CCTTGATTCTCATGGTCTGAG 3'. Superfically wild-type.

Internal eGFP and FLAG tags with poly-A linkers inserted into endogenous lat-1 locus before 651 aa. Reference: Carmona-Rosas G, et al. bioRxiv 2023.05.04.539414; doi: https://doi.org/10.1101/2023.05.04.539414.

Engineered F69A mutation in endogenously-tagged lat-1 locus. Slightly reduced brood size. syb8408 is internal eGFP and FLAG tags with poly-A linkers inserted into endogenous lat-1 locus before 651 aa. Reference: Carmona-Rosas G, et al. bioRxiv 2023.05.04.539414; doi: https://doi.org/10.1101/2023.05.04.539414.

CRISPR/Cas9-engineered deletion of Lectin domain within endogenously-tagged LAT-1A. Internal eGFP and FLAG tags with poly-A linkers inserted into endogenous lat-1 locus before 651 aa. Reduced brood size and high levels of embryonic and larval lethality. Reference: Carmona-Rosas G, et al. bioRxiv 2023.05.04.539414; doi: https://doi.org/10.1101/2023.05.04.539414.

C30F12.6 Homozygous. Outer Left Sequence: gtataacacaagcctccgcc. Outer Right Sequence: ggagttccagccattgatgt. Inner Left Sequence: ttttcggtctctaaccacgg. Inner Right Sequence: ttggttcaaagctgttgctg. Inner Primer PCR Length: 3260. Estimated Deletion Size: about 2200 bp. Breakpoint data provided by Neline Kriek 10/2004: TTCTTTGTAAATAACTTTTTACTTTACGTTTTTGAAAACATTCTCGATCTCCAAATCTT CbreakpointATTGGTAATTAAAATCAATAATTTCGATTCAGTGTGATCCCACTTAAA TTTTATACATTG. [NOTE: (March 2019) The Moerman lab confirms that diagnostic PCR with one primer internal to the deletion and one external yields the expected product from N2 and no product from RB1284. Primer sequences (5'->3') were ttttcggtctctaaccacgg and gaaacaagcccactcactac.] Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

YY63D3A.10. Homozygous. Outer Left Sequence: AGGTGGAAGGGATGGCTATT. Outer Right Sequence: GCTTCCTTGACTCTCCGTTG. Inner Left Sequence: GAAATTTGCACTCCAGGGAA. Inner Right Sequence: TAGTCTGGAAGGAGCGCTGT. Inner Primer PCR Length: 3267 bp. NOTE: External left primer occurs twice in Y63D3A, once at coordinate 1234 and once at coordinate 3721, giving external WT products of 3493 and 1006 bp respectively. Shorter product is apparently preferred in PCR. Reactions on mutant template using ok2243_external primers thus primarily gives a product from EL(3721) and ER. Nested amplification on this product using ok2243_internal primers appears to give a product from EL(3721) (remaining primer from the external round passed to internal round by product transfer) and IR. Deletion Size: 219 bp. Deletion left flank: CCACTTCAGTCTTGATGCTGCGCTCGTGCC. Deletion right flank: TGTCACTAGCTCTATATTCAAGTCTCCTCG. Insertion Sequence: TTTTGTTCT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C16C8.16. Homozygous. Outer Left Sequence: AAGACGACCACACTCTCGCT. Outer Right Sequence: ACACTGGGAAAAATGTTCGG. Inner Left Sequence: TGCCGATACTAAAGTTCCCG. Inner Right Sequence: GGACTACGGTAGGTGGCAGA. Inner Primer PCR Length: 3110 bp. Deletion Size: 1331 bp. Deletion left flank: ATTGTTCGAAAATTTGATGTCGGAATTGAA. Deletion right flank: GACTGTCAAAGCCGAGCTGAATGTGACGAA. Interpretation of sequence data is very speculative, and should be confirmed independently. Predominant band in PCR of mutants, about 600 bp, is probably not the full-length mutant product. Full-length mutant product is more likely a fainter band of about 1770 bp, which correlates well with deduced breakpoints and relative sizes of various bands produced by single-round amplification with external and internal primer pairs. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

hrtSi41 [des-2p::unc-33L::GFP + unc-119(+)] I. hrtSi41 inserted into ttTi4348. UNC-33L::GFP expression in PVD and FLP. Functional UNC-33::GFP fusion with internal GFP tag inserted at the start of the S isoform. Reference: He L, et al. eLife 2020;9:e55111 doi: 10.7554/eLife.55111.

Y54G9A.6. IR sensitive. To genotype: External left primer: GTCCCGTTTCCCCCATTTG. External right primer: CTCTTCATCATCTCCTCTCC. Internal right primer: CTCCTCCGAACGCTACTT. External WT amplicon: 1970 bp. External mutant amplicon: 1635 bp. Internal WT amplicon: 1534 bp. Reference: Bertolini S, et al. G3 (Bethesda). 2017 Dec 4;7(12):3875-3885. Kim T, et al. J Cell Biol. 2015 May 25;209(4):507-17.

ZC328.4. IR sensitive. External left primer: AACAAGAAGGGGAAGAAAGA. External right primer: TGTCTCATCGAAATCCAACT. Internal Left Sequence: AGGAAGAAACGAGAAAAGCA. External WT amplicon: 1420 bp. External mutant amplicon: 428 bp. Internal WT amplicon: 720 bp. Reference: Bertolini S, et al. G3 (Bethesda). 2017 Dec 4;7(12):3875-3885.

Light sensation defect; loss of light sensation. lite-1(xu492) is a 2701 bp deletion generated by CRISPR/Cas9-based gene editing using the Fire Lab protocol (Arribere et al., 2014). Left flanking sequence: 5’ CGTAAAAAACAACATGCCACCAC Right flanking sequence: 5' GGCGGCCACCTACGCCAGTA. Primer sequences used to detect the deletion: Forward (flanking): 5’ GAAGAAAAGGCGGTGCAAAC; Reverse (flanking): 5’ GAAGCAACAAGACGATCTCC; Forward (internal): 5’ ATGATCGCAAAAATCCTGTCGAGTC. Wild-type product: 1972 bp; xu492 product: 1475 bp; both bands should be visible if heterozygous. Reference: Zhang W, et al. PLoS Genet. 2020 Dec 10;16(12):e1009257. doi: 10.1371/journal.pgen.1009257. eCollection 2020 Dec.

yDf20 previously known as y288. Internal deletion. Takes out dpy-3 and lin-32. Heterozygotes are Unc.