Strain Information
| Name | RB1284 View On Wormbase |
|---|---|
| Species | C. elegans |
| Genotype | C30F12.6(ok1381) I. |
| Description | C30F12.6 Homozygous. Outer Left Sequence: gtataacacaagcctccgcc. Outer Right Sequence: ggagttccagccattgatgt. Inner Left Sequence: ttttcggtctctaaccacgg. Inner Right Sequence: ttggttcaaagctgttgctg. Inner Primer PCR Length: 3260. Estimated Deletion Size: about 2200 bp. Breakpoint data provided by Neline Kriek 10/2004: TTCTTTGTAAATAACTTTTTACTTTACGTTTTTGAAAACATTCTCGATCTCCAAATCTT CbreakpointATTGGTAATTAAAATCAATAATTTCGATTCAGTGTGATCCCACTTAAA TTTTATACATTG. [NOTE: (March 2019) The Moerman lab confirms that diagnostic PCR with one primer internal to the deletion and one external yields the expected product from N2 and no product from RB1284. Primer sequences (5'->3') were ttttcggtctctaaccacgg and gaaacaagcccactcactac.] Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| Mutagen | UV/TMP |
| Outcrossed | x0 |
| Made by | OMRF Knockout Group |
| Laboratory | RB |
Sign in
or
register an account if you want to order this strain.