Strain Information
| Name | NK3325 View On Wormbase |
|---|---|
| Species | C. elegans |
| Genotype | qySi316 I. |
| Description | qySi316 [nuo-1p::mNG::P2A::mKate2::unc-54 3'UTR] I. Transcriptional nuo-1 reporter fused to mNeonGreen and mKate2 inserted into ttTi4348 mosSCI site (I:-5.32) using CRISPR/Cas9-mediated recombination. Internal mKate2 reverse primer: 5' CCTTGATTCTCATGGTCTGAG 3'. Superfically wild-type. |
| Mutagen | Crispr/Cas9 |
| Outcrossed | x0 |
| Made by | Isabel Kenny-Ganzert |
| Laboratory | NK |
Sign in
or
register an account if you want to order this strain.