Strain Information

Name NK3325   View On Wormbase
Species C. elegans
GenotypeqySi316 I.
DescriptionqySi316 [nuo-1p::mNG::P2A::mKate2::unc-54 3'UTR] I. Transcriptional nuo-1 reporter fused to mNeonGreen and mKate2 inserted into ttTi4348 mosSCI site (I:-5.32) using CRISPR/Cas9-mediated recombination. Internal mKate2 reverse primer: 5' CCTTGATTCTCATGGTCTGAG 3'. Superfically wild-type.
MutagenCrispr/Cas9
Outcrossedx0
Made byIsabel Kenny-Ganzert
Laboratory NK
Sign in or register an account if you want to order this strain.