Strain Information
| Name | TQ8245 View On Wormbase |
|---|---|
| Species | C.elegans |
| Genotype | lite-1(xu492) X. |
| Description | Light sensation defect; loss of light sensation. lite-1(xu492) is a 2701 bp deletion generated by CRISPR/Cas9-based gene editing using the Fire Lab protocol (Arribere et al., 2014). Left flanking sequence: 5’ CGTAAAAAACAACATGCCACCAC Right flanking sequence: 5' GGCGGCCACCTACGCCAGTA. Primer sequences used to detect the deletion: Forward (flanking): 5’ GAAGAAAAGGCGGTGCAAAC; Reverse (flanking): 5’ GAAGCAACAAGACGATCTCC; Forward (internal): 5’ ATGATCGCAAAAATCCTGTCGAGTC. Wild-type product: 1972 bp; xu492 product: 1475 bp; both bands should be visible if heterozygous. Reference: Zhang W, et al. PLoS Genet. 2020 Dec 10;16(12):e1009257. doi: 10.1371/journal.pgen.1009257. eCollection 2020 Dec. |
| Mutagen | No mutagen |
| Outcrossed | x6 |
| Made by | Xinxing Zhang |
| Laboratory | TQ |
| Reference | Regulation of photosensation by hydrogen peroxide and antioxidants in C. elegans, Published: December 10, 2020https://doi.org/10.1371/journal.pgen.1009257 This information will be updated in the future. |
Sign in
or
register an account if you want to order this strain.