Strain Information
| Name | NK2765 View On Wormbase |
|---|---|
| Species | C. elegans |
| Genotype | qySi120[eef-1A.1p::iATPSnFR1.0::unc-54 3'UTR] I. |
| Description | Superfically wild-type strain with ubiquitous somatic expression of ATP biosensor iATPSnFR1.0 inserted into ttTi4348 mosSCI site (I:-5.32) using CRISPR/Cas9-mediated recombination. Internal iATPSnFR1.0 reverse primer: 5' CTTCATCTCGGCGACGGAGAGACGGTT 3' |
| Mutagen | Crispr/Cas9 |
| Outcrossed | x0 |
| Made by | Isabel Kenny-Ganzert, Qiuyi Chi |
| Laboratory | NK |
Sign in
or
register an account if you want to order this strain.