Strain Information

Name NK2765   View On Wormbase
Species C. elegans
GenotypeqySi120[eef-1A.1p::iATPSnFR1.0::unc-54 3'UTR] I.
DescriptionSuperfically wild-type strain with ubiquitous somatic expression of ATP biosensor iATPSnFR1.0 inserted into ttTi4348 mosSCI site (I:-5.32) using CRISPR/Cas9-mediated recombination. Internal iATPSnFR1.0 reverse primer: 5' CTTCATCTCGGCGACGGAGAGACGGTT 3'
MutagenCrispr/Cas9
Outcrossedx0
Made byIsabel Kenny-Ganzert, Qiuyi Chi
Laboratory NK
Sign in or register an account if you want to order this strain.