Light sensation defect; loss of light sensation. lite-1(xu492) is a 2701 bp deletion generated by CRISPR/Cas9-based gene editing using the Fire Lab protocol (Arribere et al., 2014). Left flanking sequence: 5’ CGTAAAAAACAACATGCCACCAC Right flanking sequence: 5' GGCGGCCACCTACGCCAGTA. Primer sequences used to detect the deletion: Forward (flanking): 5’ GAAGAAAAGGCGGTGCAAAC; Reverse (flanking): 5’ GAAGCAACAAGACGATCTCC; Forward (internal): 5’ ATGATCGCAAAAATCCTGTCGAGTC. Wild-type product: 1972 bp; xu492 product: 1475 bp; both bands should be visible if heterozygous. Reference: Zhang W, et al. PLoS Genet. 2020 Dec 10;16(12):e1009257. doi: 10.1371/journal.pgen.1009257. eCollection 2020 Dec.

Defective response to short wavelength light; response strongly reduced but not eliminated. All other characteristics seem wild type, including reponse to mechanosensory stimuli. Strong, probably null, allele. This mutation also blocks the coordinated light response of unc-31(e928) and egl-30(ad805). To identify lite-1 homozygous mutants when crossing into different backgrounds, use a fluorescence stereomicroscope with a GFP filter and zoom to the hightest magnification (60-100X) to distinguish Lite from non-Lite animals. This works best when the animals are mired in thicker parts of the food to slow their spontaneous locomotion but not their response to light. Scan animals around the edge of the food where it is thickest. Leave the lid of the plate off for a minute or so before starting to let the animals adjust to air currents.

C14F11.3. Homozygous. Outer Left Sequence: CAAAGTCGCGAACAATTGAA. Outer Right Sequence: CGCTTGAGTGGGCTTTACTC. Inner Left Sequence: TGGCAAATTGCTTTGGGTAT. Inner Right Sequence: CAAGAAGACCATGATCGCAA. Inner primer WT PCR product: 3355. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Defective phototaxis (light avoidance). To identify lite-1(xu7) homozygotes, place day 1 adults on a freshly seeded NGM plate with a thin lawn of OP50. Deliver 2 second pulses of short wavelength light (UV, purple, blue) from an arc lamp to the head of a worm that is slowly moving forward through a 5-10x objective lens in conjunction with a room lens under a fluorescent dissection scope. Manually move the plate so only the anterior of the worm appears in the field of view. Wild-type worms respond by initiating reversals while homozygous mutants do not. Maintain under normal conditions. Reference: Liu J, et al (2010) Nature Neurosci 13:715-22.

wtfIs3 [rab-3p::NLS::GFP + rab-3p::NLS::tagRFP]. Worms expressing the calcium insensitive fluorescent proteins GFP and tagRFP in the nuclei of all neurons in a lite-1(ce314) background. Control strain for AML70. Reference: https://www.biorxiv.org/content/biorxiv/early/2018/10/17/445643.full.pdf

wtfIs5 [rab-3p::NLS::GCaMP6s + rab-3p::NLS::tagRFP]. Integrated calcium indicator GCaMP6s and calcium-insensitive fluorescent protein RFP in the nuclei of all neurons in a lite-1(ce314) mutant background. Derived from parental strain AML14 by integration of wtfEx4. Reference: Gauthey W, et al. Curr Biol. 2024 Jan 8;34(1):R14-R15. doi: 10.1016/j.cub.2023.10.043. PMID: 38194919.

otIs644 [tdc-1::ChR2::YFP]. Reporter contains 4.4 kb of tdc-1 promoter fused to ChR2::YFP; can be used for optogenetic stimulation of tyraminergic and octopaminergic neurons.

xuEx705 [npr-9p::GCaMP3.0 + npr-9::DsRed2B]. Superficially wild-type. Maintain by picking red fluorescent animals; DsRed might not be visible at lower magnifications. Reference: Piggott BJ, et al. Cell. 2011 Nov 11;147(4):922-33.

xuEx1040 [nmr-1p::G-CaMP3.0 + nmr-1p::DsRed]. Pick fluorescent animals to maintain. Reference: Piggott BJ, et al. Cell. 2011 Nov 11;147(4):922-33.

zxIs12 [F49H12.4P::ChR2(H134R)::mCherry + F49H12.4P::GFP]. Strain expresses Channelrhodopsin-2 (ChR2(H134R)::mCherry) and GFP (as marker) in PVD and AQR, as well as in a non-identified tail neuron, using the F49H12.4 promoter (see also ZX679). When grown in the presence of all-trans retinal and illuminated with blue light, animals show strong forward locomotion escape behavior, which can be quantified using locomotion video tracking. The strain can be used to analyze function of PVD cells, and to estimate the role of specific genes in the function of this polymodal nociceptor, downstream of depolarization via ChR2. All-trans retinal needs to be added with OP50 bacteria when seeding plates to render ChR2 functional. This strain is in lite-1(ce314) background, which eliminates the photophobic behavioral response that will be startled by blue light when longer light stimuli are used (>1s). To not confuse the photophobic behavior induced by LITE-1, with the PVD evoked escape behavior, this strain is needed for experiments with prolonged photostimulation. References: Husson S, et al. Curr Biol. 2012 May 8;22(9):743-52. Smith CJ, et al. Neuron. 2013 Jul 24;79(2):266-80. Cohen E, et al. Molecular and Cellular Neuroscience 2104 59C: 85-96.

Defective locomotion in response to blue/UV light. Double mutant has almost no response to light. Reference: Bhatla N & Horvitz HR. Neuron. 2015 Feb 18;85(4):804-18.

zdIs5 [mec-4p::GFP + lin-15(+)] I. zfEx416 [rig-3p::GFP::SL2::mCherry]. Pick animals with red fluorescence to maintain zfEx416. Reference: Shipley FB, et al. Front Neural Circuits. 2014 Mar 24;8:28.

Maintain at 15C. No Progeny at 25C; little response to blue light. References: Granato M, et al. Nucleic Acids Res. 1994 May 11;22(9):1762-3. Edwards SL, et al. PLoS Biol. 2008 Aug 5;6(8):e198.

sraIs49 contains [nmr-1p::G-CaMP + unc-119(+)]. sraEx80 contains [sra-6p::chop-2(H134R)::mCherry + osm-10p::G-CaMP + unc-122p::mCherry]. Superficially wild-type. Maintain by picking red fluorescent worms.

sraIs49 contains [nmr-1p::G-CaMP + unc-119(+)]. sraEx83 contains [tdc-1p::chop-2(H134R)::mCherry + F55B11.3p::mCherry]. Superficially wild-type. Maintain by picking red fluorescent worms.

ljIs123 [mec-4p::ChR2(H134R)::YFP(codon-optimized) + unc-122p::RFP]. zxEx621 [glr-1p::Mac::mCherry + elt-2p::GFP]. Pick animals with robust GFP expression in intestinal nuclei to maintain.

sraEx230 [str-2p::Arch::TagRFP + pBX(pha-1(+))]. Maintain at 25C. This transgenic line expresses TagRFP in AWC(on) and has little response to blue light in the absence of ATR. In the presence of ATR the reversal rate of the animal is decreased upon symmetrical stimulation, and asymmetrical stimulation causes the worm to turn in the same direction the head was bent when AWC(on) was inhibited. Reference: Kocabas A, et al. Nature. 2012 Sep 23. doi: 10.1038/nature11431.

sraEx278 [npr-9p::Arch::TagRFP + pBX(pha-1(+))]. Maintain at 25C. This transgenic line expresses TagRFP in AIB and has little response to blue light in the absence of ATR. In the presence of ATR the reversal rate of the animal is decreased upon symmetrical stimulation. Reference: Kocabas A, et al. Nature. 2012 Sep 23. doi: 10.1038/nature11431.

sraEx279 [ttx-3p::Arch::TagRFP + pBX(pha-1(+))]. Maintain at 25C. This transgenic line expresses TagRFP in AIY and has little response to blue light in the absence of ATR. In the presence of ATR the reversal rate of the animal is increased upon symmetrical stimulation, and asymmetrical stimulation causes the worm to turn in the opposite direction to which the head was bent when AIY was excited. Reference: Kocabas A, et al. Nature. 2012 Sep 23. doi: 10.1038/nature11431.

sraEx281 [ttx-3p::chop-2(H134R)::TagRFP + pBX(pha-1(+))]. Maintain at 25C. This transgenic line expresses TagRFP in AIY and has little response to blue light in the absence of ATR. In the presence of ATR the reversal rate of the animal is decreased upon symmetrical stimulation, and asymmetrical stimulation causes the worm to turn in the same direction the head was bent when AIY was excited. Reference: Kocabas A, et al. Nature. 2012 Sep 23. doi: 10.1038/nature11431.

sraEx291 [npr-9p::chop-2(H134R)::TagRFP + pBX(pha-1(+))]. Maintain at 25C. This transgenic line expresses TagRFP in AIB and has little response to blue light in the absence of ATR. In the presence of ATR the reversal rate of the animal is increased upon symmetrical stimulation. Reference: Kocabas A, et al. Nature. 2012 Sep 23. doi: 10.1038/nature11431.

sraEx301 [str-2p::chop-2(H134R)::TagRFP + str-2p::TagRFP + pBX(pha-1(+))]. Maintain at 25C. This transgenic line expresses TagRFP in AWC(on) and has little response to blue light in the absence of ATR. In the presence of ATR the reversal rate of the animal is increased upon symmetrical stimulation, and asymmetrical stimulation causes the worm to turn in the opposite direction to which the head was bent when AWC(on) was excited. Reference: Kocabas A, et al. Nature. 2012 Sep 23. doi: 10.1038/nature11431.

sraEx306 [ser-2(prom2)::chop-2(H134R)::TagRFP + ser-2(prom2)::mKO + pBX(pha-1(+))]. Maintain at 25C. This transgenic line expresses mKO and TagRFP in AIY, AIZ and RME in the head, and has little response to blue light in the absence of ATR. In the presence of ATR asymmetrical stimulation of AIY causes the worm to turn in the same direction the head was bent when AIY was excited, whereas asymmetrical stimulation of AIZ or RME causes the worm to turn in the opposite direction to which the head was bent when AIZ or RME was excited. Reference: Kocabas A, et al. Nature. 2012 Sep 23. doi: 10.1038/nature11431.

sraEx329 [odr-2(18)p::chop-2(H134R)::TagRFP + odr-2(18)p::mKO + pBX(pha-1(+))]. Maintain at 25C. This transgenic line expresses mKO and TagRFP in SMB in the head, and has little response to blue light in the absence of ATR. In the presence of ATR asymmetrical stimulation of SMB causes the worm to turn in the same direction the head was bent when SMB was excited. Reference: Kocabas A, et al. Nature. 2012 Sep 23. doi: 10.1038/nature11431.

wzIs30 [egl-6::ChR2-YFP + lin-15(+)] IV. Strain carries integrated transgene wzIs30 that expresses YFP-tagged channelrhodopsin under the egl-6 promoter in HSN and some head and tail neurons. Strain is in lite-1(ce314) and lin-15(n765ts) background. The transgene contains a rescue for lin-15 as a marker. Reference: Emtage L, et al. J Neurosci. 2012 Nov 14;32(46):16285-95.

keyIs21 [egl-6p::HisCl::unc-54 3' UTR + egl-6p::mCherry::unc-54 3' UTR + lin-15(+)]. Animals express HisCl and mCherry in the HSN neurons, two head sheath glia, two tail neurons, and 1-2 head neurons. Expression is bright in the head and tail. Animals are slightly egg-laying defective, ~10% of animals are Egl. Reference: Ravi B, et al. J. Neuroscience. 38 (28), 6283-6298.

keyIs19 [ceh-24::HisCl::unc-54 3'UTR + lin-15(+)]. Animals express Histamine gated chloride channel (HisCl) under the ceh-24 promoter in vulval muscle, a pair of pharyngeal muscles, and two head neurons; can be used for reversible silencing of vulval muscles and inhibition of egg-laying behavior. Reference: Ravi B, et al. J. Neuroscience. 38 (28), 6283-6298.

vsIs164 [unc-103p(E)::GCaMP5 + unc-103p(E)::mCherry + lin-15(+)] X. Integrated transgene using unc-103e promoter to drive GCaMP5 and mCherry expression in vulval muscles; useful for visualizing and quantitating calcium influx in vulval muscle cells. Reference: Collins K, et al. Elife. 2016 Nov 16;5. pii: e21126. doi: 10.7554/eLife.21126.

vsIs172 [lin-11(enhancer)::pes-10p::GCaMP5 + lin-11(enhancer)::pes-10p::mCherry + lin-15(+)]. Integrated transgene using lin-11 enhancer region fused to the pes-10 basal promoter to drive GCaMP5 and mCherry expression in VC motor neurons; useful for visualizing and quantitating calcium influx in VC motor neurons. Reference: Collins K, et al. Elife. 2016 Nov 16;5. pii: e21126. doi: 10.7554/eLife.21126.

vsIs177 [ocr-2p::GCaMP5::ocr-2 3'UTR + ocr-2p::mCherry::ocr-2 3'UTR + lin-15(+)] X. Integrated transgene using ocr-2 promoter to drive GCaMP5 and mCherry expression in uv1; useful for visualizing and quantitating calcium influx in uv1 cells. Reference: Collins K, et al. Elife. 2016 Nov 16;5. pii: e21126. doi: 10.7554/eLife.21126.

vsIs183 [nlp-3p::GCaMP5::nlp-3 3'UTR + nlp-3p::mCherry::nlp-3 3'UTR + lin-15(+)] X. Integrated transgene using nlp-3 promoter to drive GCaMP5 and mCherry expression in HSN; useful for visualizing and quantitating calcium influx in HSN. Reference: Collins K, et al. Elife. 2016 Nov 16;5. pii: e21126. doi: 10.7554/eLife.21126.

wtfEx478 [rab-3p::AI::lite-1G::SL2::tagBFP::unc-54 3'UTR + unc-122p::GFP]. Pick GFP+ animals to maintain. Worms express purple/violet light-sensitive optogenetic protein LITE-1 pan-neuronallly and nuclear-localized blue fluorescent protein tagBFP via SL2 trans-slpicing regulatory sequence. Worms also express GFP in coelomocytes. Reporter construct contains an artificial intron (AI). Reference: Sharma AK, et al. Genetics 2024 May 11:iyae077. doi: 10.1093/genetics/iyae077 PMID: 38733622.

juSi164 [mex-5p::HIS-72::miniSOG + Cbr-unc-119(+)] III. wtfIs483 [rab-3p::AI::lite-1G::unc-54 3'UTR + rab-3p::AI::prdx-2G::SL2::his-24::tagRFP::unc-54 3'UTR + rab-3p::his-24::GCaMP6s::unc-54 3'UTR]. Keep plates covered to avoid unnecessary exposure to light. Pan-neuronal expression of a purple/violet light-sensitive optogenetic protein system LITE-1 and PRDX-2 with nuclear-localized tagRFP and GCaMP6s. Reporter construct contains an artificial intron (AI). Reference: Sharma AK, et al. Genetics 2024 May 11:iyae077. doi: 10.1093/genetics/iyae077 PMID: 38733622.

wtfIs5 [rab-3p::NLS::GCaMP6s + rab-3p::NLS::tagRFP]. Integrated calcium indicator GCaMP6s and calcium-insensitive fluorescent protein RFP in the nuclei of all neurons in a lite-1(ce314) gur-3(ok2245) double mutant background. Derived from parental strain AML14 by integration of wtfEx4. Reference: Gauthey W, et al. Curr Biol. 2024 Jan 8;34(1):R14-R15. doi: 10.1016/j.cub.2023.10.043. PMID: 38194919.

Engineered null mutations in predicted GPCR genes. Reference: Pu L, et al. Nat Commun. 2023 Dec 18;14(1):8410. PMID: 38110404.

domEx253 [mec-4p::Chrimson::GFP + unc-122p::RFP]. Pick animals with red fluorescence in coelomocytes to maintain. Red-light optogenetic line for gentle touch receptor neurons (TRN). Transgenic animals expressing the red light-activated channelrhodopsin Chrimson into TRNs using the mec-4 promoter. In animals grown on all trans-retinal-containing medium, red light stimuli trigger behaviors similar to those evoked by gentle touch. Note that very strong blue light stimuli may also activate Chrimson. Reference: Schild LC & Glauser DA. Genetics. 2015 Aug;200(4):1029-34. doi: 10.1534/genetics.115.177956. PMID: 26022242.

peIs1091 [gcy5p::ChR2Y2 + unc-122p::mCherry]. ChR2 expression in the ASER neuron. Reference: Kunitomo H, et al., 2013, Nat Commun. 2013;4:2210. doi: 10.1038/ncomms3210.

peIs1095 [gcy-7p::ChR2Y2::Venus + unc-122::mCherry]. ChR2Y2 expression in ASEL. Reference: Wang L, et al. J Neurosci, 2017. 37(8): p. 2097-2111. PMID: 28126744

peIs1090 [sra-6p::ChR2Y2]. ChR2 expression in ASH neuron. Reference: Yamada K, et al. 2012 Jul;2(7):741-51. PMID: 22870397

fsIs22 [osm-5p::fem-3::mCherry + unc-122p::GFP]. ljIs114 [gpa-13p?FLPase + sra-6p?FRT::mCherry::StopCodon::FRT?ChR2?YFP]. Him. Pan-ciliated masculinization with ChR2 specifically in ASH. Reference: Pechuk V., et al. 2022, Current Biology 32, 1–14. https://doi.org/10.1016/j.cub.2022.08.038

loxP sites inserted before first (eat-4(mir12[loxP 5'UTR])) and after second (eat-4(mir17[loxP intron2])) exon of eat-4 gene. Lite. Reference: Porta-de-la-Riva M, et al. Nat Methods. 2023 May;20(5):761-769. doi: 10.1038/s41592-023-01836-9. PMID: 37024651.

vlcEx1292 [srh-142p::mCherry::SL2::GCaMP3 + unc-122p::RFP]. Maintain at or below 20C; sterile at 25C. Pick animals with RFP+ coelomocytes to maintain. ADF-specific expression of GCaMP3. Reference: Maicas et al. PLOS Biology 2021; 19(7): e3001334. DOI: 10.1371/journal.pbio.3001334

flvIs17 [tag-168::NLS::GCaMP7F + gcy-28.d::NLS::tagRFPt + ceh-36::NLS::tagRFPt + inx-1::tagRFPt + mod-1::tagRFPt + tph-1(short)::NLS::tagRFPt + gcy-5::NLS-;:tagRFPt + gcy-7::NLS::tagRFPt]. flvIs18 [tag-168::NLS::mNeptune2.5]. This strain can be used for calcium imaging at whole-brain level. Back-crossed 5x to MT21793 after transgene integration. Reference: Dag U, et al. bioRxiv 2023.01.15.524132; doi: https://doi.org/10.1101/2023.01.15.524132.

flvIs17 [tag-168::NLS::GCaMP7F + gcy-28.d::NLS::tagRFPt + ceh-36::NLS::tagRFPt + inx-1::tagRFPt + mod-1::tagRFPt + tph-1(short)::NLS::tagRFPt + gcy-5::NLS-;:tagRFPt + gcy-7::NLS::tagRFPt]. See description of strain OH15263 for full description of otIs670 NeuroPAL (Neuronal Polychromatic Atlas of Landmarks) transgene (Yemini E, et al. Cell. 2021 Jan 7;184(1):272-288.e11. PMID: 33378642). This strain can be used for pan-neuronal calcium imaging. Back-crossed 5x to MT21793 after transgene integration. Reference: Dag U, et al. bioRxiv 2023.01.15.524132; doi: https://doi.org/10.1101/2023.01.15.524132.

seld-1(xu408) is a G314E missense mutation; suppresses LITE-1 function. Reference: Zhang W, et al. PLOS Genetics 2020 Dec 10;16(12):e1009257. PMID: 33301443

scbp-2(xu418) is a G47R missense mutation; suppresses LITE-1 function. Reference: Zhang W, et al. PLOS Genetics 2020 Dec 10;16(12):e1009257. PMID: 33301443

gspd-1(xu416) is a E375K missense mutation; suppresses LITE-1 function. Reference: Zhang W, et al. PLOS Genetics 2020 Dec 10;16(12):e1009257. PMID: 33301443

gspd-1(xu409) is a L369F missense mutation; suppresses LITE-1 function. Reference: Zhang W, et al. PLOS Genetics 2020 Dec 10;16(12):e1009257. PMID: 33301443

gsr-1(xu413) is a S21F missense mutation; suppresses LITE-1 function. Reference: Zhang W, et al. PLOS Genetics 2020 Dec 10;16(12):e1009257. PMID: 33301443

seld-1(xu415) is a G170E missense mutation; suppresses LITE-1 function. Reference: Zhang W, et al. PLOS Genetics 2020 Dec 10;16(12):e1009257. PMID: 33301443