More Fields
Strain Species Genotype
ABR339 C. elegans lpin-1(wbm76[lpin-1::GFP]) V. Show Description
GFP tag inserted into endogenous lpin-1 locus. The strain was generated by using 5' attgttgctggcatcaaaaa crRNA for C-terminal lpin-1 editing and using dpy-10 editing as a co-conversion marker, followed by outcrossing twice to ABR lab stock of N2 to eliminate the dpy-10 co-conversion marker. Reference: Papsdorf et al, Nature Cell Biology, 2023, PMID 37127715. [NOTE: This strain was incorrectly named WBM1369 lpin-1(sta10[lpin-1::GFP]) in an earlier version of the paper.]
AD296 C. elegans spe-51(syb2737[spe-51::mNeonGreen]) IV; him-5(e1490) V. Show Description
mNeonGreen tag inserted into the endogenous spe-51 locus. Him. Reference: Mei X, et al. Curr Biol. 2023 Jul 3;S0960-9822(23)00780-7. doi: 10.1016/j.cub.2023.06.029. PMID: 37453427.
AD319 C. elegans spe-38(syb6556[spe-38::wrmScarlet-I]) I; him-5(e1490) V. Show Description
wrmScarlet-I tag inserted into endogenous spe-38 locus. Him. wrmScarlet-I expression labels membranous organelles (MOs) in the sperm. Reference: Zuo Y, et al. Biomolecules. 2023; 13(4):623. https://doi.org/10.3390/biom13040623
ALF9 C. elegans unc-119(ed3) III; daf-12(rh61rh411) X; bafIs9. Show Description
bafIs9 [daf-12::TAP (fosmid) + unc-119(+)]; rescues both daf-12 and unc-119. TAP tag inserted into daf-12 fosmid. Reference: Hochbaum D, et al. PLoS Genet. 2011 Jul;7(7):e1002179.
AMP100 C. elegans ieSi57 II; rpb-2(cer135[rpb-2::GFP(delta)piRNA::AID::3xFLAG]) III. Show Description
ieSi57 [eft-3p::TIR1::mRuby::unc-54 3'UTR + Cbr-unc-119(+)] II. cer135 is a rpb-2::GFP(delta)piRNA::AID::3xFLAG tag inserted into the endogenous rpb-2 locus. This strain allows auxin-dependent disruption of RNA polymerase II with dose-dependent lifespan shortening. Reference: Oswal N, et al. PLoS Comput Biol. 2022 Sep 30;18(9):e1010415. PMID: 36178967.
AWR41 C. elegans lin-35(kea7[lin-35p::degron::GFP::lin-35]) I. Show Description
N-terminal degron::GFP tag was inserted into the endogenous lin-35 locus. Generated in N2 background. Reference: Willis AR, et al. Sci Adv. 2021 May 5;7(19):eabf3114. PMID: 33952520 [NOTE: lin-35(kea7) is an N-terminal tag; the methods section of the paper incorrectly describes the tag as a C-terminal insertion.]
AWR45 C. elegans pals-22(kea8[pals-22::GFP::degron]) III. Show Description
C-terminal GFP::degron tag was inserted into the endogenous pals-22 locus. Generated in N2 background. Reference: Willis AR, et al. Sci Adv. 2021 May 5;7(19):eabf3114. PMID: 33952520 [NOTE: pals22(kea8) is a C-terminal tag; the methods section of the paper incorrectly describes the tag as an N-terminal insertion.]
AWR54 C. elegans lin-35(kea7[lin-35p::degron::GFP::lin-35]) I; ieSi57 II. Show Description
ieSi57 [eft-3p::TIR1::mRuby::unc-54 3’UTR + Cbr-unc-119(+)] II. N-terminal degron::GFP tag was inserted into the endogenous lin-35 locus. A single copy insertion of eft-3p::TIR1::mRuby allows auxin-inducible degradation of LIN-35 in somatic tissues. Generated in N2 background. Reference: Willis AR, et al. Sci Adv. 2021 May 5;7(19):eabf3114. PMID: 33952520 [NOTE: lin-35(kea7) is an N-terminal tag; the methods section of the paper incorrectly describes the tag as a C-terminal insertion.]
AWR56 C. elegans lin-35(kea7[lin-35p::degron::GFP::lin-35]) I; ieSi64 II. Show Description
ieSi64 [gld-1p::TIR1::mRuby::unc-54 3’UTR + Cbr-unc-119(+)] II. N-terminal degron::GFP tag was inserted into the endogenous lin-35 locus. A single copy insertion of gld-1p::TIR1::mRuby allows for auxin inducible degradation of LIN-35 in the germline. Generated in N2 background. Reference: Willis AR, et al. Sci Adv. 2021 May 5;7(19):eabf3114. PMID: 33952520 [NOTE: lin-35(kea7) is an N-terminal tag; the methods section of the paper incorrectly describes the tag as a C-terminal insertion.]
AWR58 C. elegans lin-35(kea7[lin-35p::degron::GFP::lin-35]) I; keaSi10 II. Show Description
keaSi10 [rpl-28p::TIR1::mRuby::unc-54 3’UTR + Cbr-unc-119(+)] II. N-terminal degron::GFP tag was inserted into the endogenous lin-35 locus. A single copy insertion of rpl-28::TIR1::mRuby allows auxin-inducible degradation of LIN-35 throughout the animal. Generated in N2 background. Reference: Willis AR, et al. Sci Adv. 2021 May 5;7(19):eabf3114. PMID: 33952520 [NOTE: lin-35(kea7) is an N-terminal tag; the methods section of the paper incorrectly describes the tag as a C-terminal insertion.]
AWR59 C. elegans keaSi10 II; pals22(kea8[pals-22::GFP::degron]) III. Show Description
keaSi10 [rpl-28p::TIR1::mRuby::unc-54 3’UTR + Cbr-unc-119(+)] II. C-terminal GFP::degron tag was inserted into the endogenous pals-22 locus. A single copy insertion of rpl-28::TIR1::mRuby allows auxin-inducible degradation of PALS-22 throughout the animal. Generated in N2 background. Reference: Willis AR, et al. Sci Adv. 2021 May 5;7(19):eabf3114. PMID: 33952520 [NOTE: pals22(kea8) is a C-terminal tag; the methods section of the paper incorrectly describes the tag as an N-terminal insertion.]
AWR61 C. elegans keaSi11 II; pals22(kea8[pals-22::GFP::degron]) III. Show Description
keaSi11 [vit-2p::TIR1::mRuby::unc-54 3’UTR + Cbr-unc-119(+)] II. C-terminal GFP::degron tag was inserted into the endogenous pals-22 locus. A single copy insertion of vit-2p::TIR1::mRuby allows for auxin inducible degradation in the adult intestine. Generated in N2 background. Reference: Willis AR, et al. Sci Adv. 2021 May 5;7(19):eabf3114. PMID: 33952520 [NOTE: pals22(kea8) is a C-terminal tag; the methods section of the paper incorrectly describes the tag as an N-terminal insertion.]
AWR62 C. elegans keaSi9 II; pals22(kea8[pals-22::GFP::degron]) III. Show Description
keaSi9 [myo-3p::TIR1::mRuby::unc-54 3’UTR + Cbr-unc-119(+)] II. C-terminal GFP::degron tag was inserted into the endogenous pals-22 locus. A single copy insertion of myo-3p::TIR1::mRuby allows for auxin inducible degradation in the body wall muscles. Generated in N2 background. Reference: Willis AR, et al. Sci Adv. 2021 May 5;7(19):eabf3114. PMID: 33952520 [NOTE: pals22(kea8) is a C-terminal tag; the methods section of the paper incorrectly describes the tag as an N-terminal insertion.]
AWR63 C. elegans keaSi12 II; pals22(kea8[pals-22::GFP::degron]) III. Show Description
keaSi12 [dpy-7p::TIR1::mRuby::unc-54 3’UTR + Cbr-unc-119(+)] II. C-terminal GFP::degron tag was inserted into the endogenous pals-22 locus. A single copy insertion of dpy-7p::TIR1::mRuby allows for auxin inducible degradation in the epidermis. Generated in N2 background. Reference: Willis AR, et al. Sci Adv. 2021 May 5;7(19):eabf3114. PMID: 33952520 [NOTE: pals22(kea8) is a C-terminal tag; the methods section of the paper incorrectly describes the tag as an N-terminal insertion.]
AWR64 C. elegans kea15 II; pals22(kea8[pals-22::GFP::degron]) III. Show Description
kea15 [rgef-1p::TIR1::mRuby::unc-54 3’UTR + Cbr-unc-119(+)] II. C-terminal GFP::degron tag was inserted into the endogenous pals-22 locus. A single copy insertion of rgef-1p::TIR1::mRuby allows for auxin inducible degradation in neurons. Generated in N2 background. Reference: Willis AR, et al. Sci Adv. 2021 May 5;7(19):eabf3114. PMID: 33952520 [NOTE: pals22(kea8) is a C-terminal tag; the methods section of the paper incorrectly describes the tag as an N-terminal insertion.]
AX7884 C. elegans pod-2(syb1772[pod-2::His10]) II; mccc-1(syb1666[mccc-1::His10]) IV; pyc-1(syb1680[pyc-1::His10]) V; pcca-1(syb1626[pcca-1::His10]) X. Show Description
Superficially wild-type. Referred to as MP3-His. Strain can be used to biotinylated carboxylases from worm extracts. AX7884 obtained by crossing parental strains PHX1772 pod-2(syb1772[pod-2::His10]) II, PHX1666 mccc-1(syb1666[mccc-1::His10]) IV, PHX1680 pyc-1(syb1680[pyc-1::His10]) V and PHX1626 pcca-1(syb1626[pcca-1::His10]) X to obtain the quadruple His10-tagged strain. The 5xGlycine(G-linker)-His10 tag is a 45 bp sequence (GGAGGAGGAGGAGGACACCATCACCATCACCACCACCACCACCAC) encoding five glycine as a linker and ten histidine residues was knocked in at the C terminus-just upstream of the termination codon-of each of the four carboxylases. Reference: Artan M, et al. J Biol Chem. 2022 Aug 3:102343. doi: 10.1016/j.jbc.2022.102343. Epub ahead of print. PMID: 35933017.
BFF68 C. elegans mjIs134 II; hrde-1(pig6[degron::ha::hrde-1]) III. Show Description
mjIs134 [mex-5p::GFP::(Gly)5Ala/his-58/tbb-2 3'UTR + Cbr-unc-119(+)] II. N-terminal Auxin-Inducible Degron and HA tag inserted into the endogenous hrde-1 locus. gfp fluorescence in germline (mex-5::gfp). Control strain for BFF69; does not carry TIR1 transgene necessary for the degradation. hrde-1(pig6) crRNA sequence: CAUAAUUUUGUCGAGCAAGU. Reference: Toker IA, et al. (2020). Transgenerational Regulation of Sexual Attractiveness in C. elegans Nematodes. bioRxiv.
BFF69 C. elegans mjIs134 II; hrde-1(pig6[degron::ha::hrde-1]) III; ieSi38 IV. Show Description
mjIs134 [mex-5p::GFP::(Gly)5Ala/his-58/tbb-2 3'UTR + Cbr-unc-119(+)] II. ieSi38 [sun-1p::TIR1::mRuby::sun-1 3'UTR + Cbr-unc-119(+)] IV. N-terminal Auxin-Inducible Degron and HA tag inserted into the endogenous hrde-1 locus. Germline-expressed TIR1 and germline GFP. Allows for the degradation of hrde-1 and heritable RNAi deficiency in the presence of auxin. hrde-1(pig6) crRNA sequence: CAUAAUUUUGUCGAGCAAGU. Reference: Toker IA, et al. (2020). Transgenerational Regulation of Sexual Attractiveness in C. elegans Nematodes. bioRxiv.
BN581 C. elegans baf-1(bq13[mCherry::baf-1]) III. Show Description
mCherry tag inserted into endogenous baf-1 locus after the start codon using by CRISPR/Cas9 engineering. Reference: Fragoso-Luna A, et al. 2021 bioRxiv 2021.12.21.473632; doi: https://doi.org/10.1101/2021.12.21.473632
BOX213 C. elegans erm-1(mib15[erm-1::eGFP]) I. Show Description
Endogenous erm-1 locus tagged with eGFP. Homozygous viable, partially functional endogenous erm-1 tag. erm-1::GFP animals have a reduced brood size and incomplete outgrowth of the excretory canal, but show no other developmental or morphological abnormalities.
BOX215 C. elegans erm-1(mib16[erm-1[T544D]::GFP]) I. Show Description
Homozygous viable. Endogenous erm-1 locus tagged with eGFP and modified to mimic ERM-1(T544) phosphorylation. Variant affects ERM-1 localization and dynamics. Reduced brood size, increased embryonic and larval lethality. eGFP-tagged ERM-1 is not fully functional: animals have a reduced brood size and incomplete outgrowth of the excretory canal, but show no other developmental or morphological abnormalities. The penetrance of intestinal phenotypes is slightly higher than in untagged T544 mutants, presumably owing to a detrimental influence of the COOH-terminal GFP tag. Reference: Ramalho JJ, et al. Development. 2020 Jul 22;147(14):dev188011. PMID: 32586975
BOX218 C. elegans erm-1(mib19[erm-1[T544A]::GFP]) I. Show Description
Homozygous viable. Endogenous erm-1 locus tagged with eGFP and modified to mimic non-phosphorylated ERM-1(T544). Variant affects ERM-1 localization and dynamics. Reduced brood size, increased embryonic and larval lethality. eGFP-tagged ERM-1 is not fully functional: animals have a reduced brood size and incomplete outgrowth of the excretory canal, but show no other developmental or morphological abnormalities. The penetrance of intestinal phenotypes is slightly higher than in untagged T544 mutants, presumably owing to a detrimental influence of the COOH-terminal GFP tag. Reference: Ramalho JJ, et al. Development. 2020 Jul 22;147(14):dev188011. PMID: 32586975
BR7205 C.elegans endu-2(by190[endu-2::eGFP]) X. Show Description
eGFP tag inserted into the endogenous endu-2 locus. Reference: Qi W, et al. (2020) A secreted endoribonuclease ENDU-2 from the soma protects germline immortality in C. elegans. BioRxiv. doi: 10.1101/2020.12.04.408260. Accepted by Nature Communications.
BV70 C. elegans unc-119(ed3) III; zbIs2. Show Description
zbIs2 [pie-1p::lifeact::RFP::pie-1 3' UTR + unc-119(+)]. Lifeact tag labels F-actin without interfering F-actin dynmics. The strain has never been officially published; however, a GFP version of this transgene is described in Pohl C & Bao Z. Dev Cell. 2010 Sep 14;19(3):402-12. PMID: 20833362.
CA1207 C. elegans dhc-1(ie28[dhc-1::degron::GFP]) I. Show Description
A degron::GFP tag was inserted at the 3' end of the endogenous dhc-1 coding sequence via CRISPR/Cas9. This strain can be combined with different TIR1 strains to examine spatial and temporal requirements for dynein, and to serve as a control strain for auxin-inducible degradation (AID). Reference: Zhang L, et al. Development. 2015 Nov 9. pii: dev.129635.
CA1210 C. elegans dhc-1(ie28[dhc-1::degron::GFP]) I; ieSi57 II. Show Description
ieSi57 [eft-3p::TIR1::mRuby::unc-54 3'UTR + Cbr-unc-119(+)] II. Single copy transgene inserted into chromosome II (oxTi179) expressing modified Arabidopsis thaliana TIR1 tagged with mRuby in the soma. A degron::GFP tag was inserted at the 3' end of the endogenous dhc-1 coding sequence via CRISPR/Cas9. This strain can be used to examine spatial and temporal requirements for dynein in somatic tissue, and to serve as a control strain for auxin-inducible degradation (AID). Reference: Zhang L, et al. Development. 2015 Nov 9. pii: dev.129635.
CA1212 C. elegans dhc-1(ie28[dhc-1::degron::GFP]) I; ieSi60 II. Show Description
ieSi60 [myo-2p::TIR1::mRuby::unc-54 3'UTR + Cbr-unc-119(+)] II. Single copy transgene inserted into chromosome II (oxTi179) expressing modified Arabidopsis thaliana TIR1 tagged with mRuby in pharyngeal muscle. A degron::GFP tag was inserted at the 3' end of the endogenous dhc-1 coding sequence via CRISPR/Cas9. This strain can be used to examine spatial and temporal requirements for dynein in pharyngeal muscle, and to serve as a control strain for auxin-inducible degradation (AID). Reference: Zhang L, et al. Development. 2015 Nov 9. pii: dev.129635.
CA1213 C. elegans dhc-1(ie28[dhc-1::degron::GFP]) I; ieSi61 II. Show Description
ieSi61 [ges-1p::TIR1::mRuby::unc-54 3'UTR + Cbr-unc-119(+)] II. A degron::GFP tag was inserted at the 3' end of the endogenous dhc-1 coding sequence via CRISPR/Cas9. Single copy transgene inserted into chromosome II (oxTi179) expressing modified Arabidopsis thaliana TIR1 tagged with mRuby in the intestine. This strain can be used to examine spatial and temporal requirements for dynein in the intestine, and to serve as a control strain for auxin-inducible degradation (AID). Reference: Zhang L, et al. Development. 2015 Nov 9. pii: dev.129635.
CA1215 C. elegans dhc-1(ie28[dhc-1::degron::GFP]) I; ieSi38 IV. Show Description
ieSi38 [sun-1p::TIR1::mRuby::sun-1 3'UTR + Cbr-unc-119(+)] IV. Single copy transgene inserted into chromosome IV (cxTi10882) expressing modified Arabidopsis thaliana TIR1 tagged with mRuby in germ line and early embryos. A degron::GFP tag was inserted at the 3' end of the endogenous dhc-1 coding sequence via CRISPR/Cas9. This strain can be used to examine spatial and temporal requirements for dynein in the germ line and early embryos, and to serve as a control strain for auxin-inducible degradation (AID). Reference: Zhang L, et al. Development. 2015 Nov 9. pii: dev.129635.
CA1216 C. elegans air-2(ie31[degron::GFP::air-2]) I. Show Description
Degron and GFP tag inserted into endogenous air-2 gene locus by CRISPR/Cas9 engineering. Reference: Divekar NS, et al. PLoS Genet. 2021 May 20;17(5):e1009567. PMID: 34014923
CA1217 C.elegans air-2(ie31[degron::gfp::air-2]) I; ieSi38 IV. Show Description
ieSi38 [sun-1p::TIR1::mRuby::sun-1 3'UTR + Cbr-unc-119(+)] IV. Degron and GFP tag inserted into endogenous air-2 gene locus by CRISPR/Cas9 engineering allows auxin-inducible degradation (AID) of AIR-2 in germ line and early embryos. Reference: Divekar NS, et al. PLoS Genet. 2021 May 20;17(5):e1009567. PMID: 34014923
CER461 C. elegans nfki-1(cer116[eGFP::nfki-1]) X. Show Description
eGFP tag inserted into the endogenous nfki-1 locus. eGFP::NFKI-1 signal is observed in diverse neurons in the animals' head and tail throughout post-embryonic development. No obvious phenotype. Reference: Brena D, et al. Sci Rep. 2020 Sep 30;10(1):16153.
CER620 C. elegans ubh-4(cer68[ubh-4::eGFP]) rpn-9(cer203[rpn-9::wrmScarlet]) II Show Description
eGFP tag inserted into endogenous ubh-4 locus. wrmScarlet tag inserted into endogenous rpn-9 locus. Reference: Martinez-Fernandez C, et al. Cells. 2023 Mar 18;12(6):929. doi: 10.3390/cells12060929. PMID: 36980270
CF4592 C. elegans muIs253 II; unc-119(ed3) III; his-3(mu496[his-3::sfGFP11]) V. Show Description
muIs253 [eft-3p::sfGFP1-10::unc-54 3'UTR + Cbr-unc-119(+)] II. Somatic expression of sfGFP1-10 (under the control of the eft-3 promoter and the unc-54 3'UTR). GFP11 tag inserted into endogenous his-3 locus via CRISPR/Cas9 insertion into parental strain CF4587. Reference: Goudeau J, et al. Genetics. 2021 Apr 15;217(4):iyab014. doi: 10.1093/genetics/iyab014. PMID: 33693628
CGC171 C. elegans mir-799(umn78[mir-799p+SL1::EGL13NLS::lox2272]) X. Show Description
Deletion of mir-799 pre-miRNA via CRISPR/CAS9 and CRE/lox. Left Flanking: ATTTTCTATTTATTGGTATAAAATATGTTA, Right Flanking: AAGAAGTACACTTCATATGCTCCTAACAAT. sgRNA: GTGAACCCTGATAAAGCTAG.
CGC172 C. elegans mir-799(umn79[mir-799p+SL1::EGL13NLS::lox2272mScarlet-I::cMycNLS::let-858 3' UTR::lox2272]) X. Show Description
Nuclear mScarlet-I was inserted in place of the endogenous mir-799 pre-miRNA via CRISPR/CAS9. Left Flanking: ATTTTCTATTTATTGGTATAAAATATGTTA, Right Flanking: AAGAAGTACACTTCATATGCTCCTAACAAT. sgRNA: GTGAACCCTGATAAAGCTAG.
CGC41 C. elegans +/szT1 [lon-2(e678) umnIs30 umnIs24] I; dpy-8(e1321) unc-3(e151)/szT1 X. Show Description
umnIs30 [myo-2p::mKate2 + NeoR, X: 6745526 (intergenic)] I. umnIs24 [myo-2p::GFP + NeoR, X: 15420938 (intergenic)] I. Carries szT1 balancer with mKate2 tag on left arm and GFP tag on right arm. Heterozygotes are wild-type GFP+ & mKate2+, and segregate wild-type GFP+ & mKate2+, DpyUnc non-GFP & non-mKate2, dead eggs and GFP+ & mKate2+ Lon males. Maintain by picking wild-type with GFP+ & mKate2+. Derived by insertion of myo-2p::mKate transgene into szT1 balancer in parental strain CGC35 using CRISPR/Cas9.
CP158 C. remanei Cre-mss-1(nm74[HA:Cre-mss-1]) III. Show Description
The hemaglutinin (HA) epitope tag was inserted using CRISPR/Cas9 through homologous recombination. The nine amino acid HA epitope was placed between C. remanei (EM464) MSS-1 residues 22 and 23, one residue downstream of the predicted mature N-terminus after signal peptide cleavage. NOTE: nm74 was originally described as nmIs9. Derived from parental strain SB146. Reference: Yin D, et al. Science. 2018 Jan 5;359(6371):55-61.
CV203 C. elegans rjSi1 II. Show Description
rjSi1 [cra-1p::cra-1::GFP::cra-1 3'UTR + Cbr-unc-119(+)] II. Single copy insertion. cra-1 promoter, cra-1::GFP and 3'UTR was cloned into pCFJ150 (ttTi5605) vector and inserted into ttTi5605 of EG4322 strain. Outcrossed three times to N2 Bristol; could still carry unc-119(ed9) in the background. Superficially wild-type. This CRA-1::GFP fusion construct has been shown to be functional and its localization reflects endogenous CRA-1 localization. rjSi1 transgene can rescue synapsis defects of cra-1 mutants and restore cross-over events (six bivalents instead of the 11 to 12 univalents characteristic of cra-1 mutants). Brood size and embryonic lethality were significantly, albeit not completely, restored in the rescued line suggesting that the GFP tag might affect other CRA-1 functions. Reference: Gao J, et al. PLOS Genetics 11(3): e1005029. https://doi.org/10.1371/journal.pgen.1005029
CY262 C. elegans sqt-1(sc13) age-1(mg44) II; bvIs1. Show Description
bvIs1 contains [ges-1p::age-1(cDNA)::unc-54 3'UTR + mec-7::GFP]. sqt-1(sc13) causes recessive left-handed rollers. bvIs1 rescues mg44 dauer arrest and partially rescues mg44 longevity. Array can be detected by PCR (Fwd: 5'-GTC ATT TTG GCA CCA TAG GAG-3' / Rev: 5'-ACC ATC GTT TGC AGT TGT GG-3'). Reference: Iser WB, Gami MS, Wolkow CA. Dev Biol. 2007 Mar 15;303(2):434-47.
CZ24092 C. elegans gip-2(lt19[gip-2::GFP::loxP::Cbr-unc-119(+)::loxP]) I; ltSi953 II; unc-119(ed3) III. Show Description
ltSi953 [mec-18p::vhhGFP4::ZIF-1::operon-linker::mKate2::tbb-2 3'UTR + Cbr-unc-119(+)] II. GFP tag inserted into the C-terminus of the endogenous gip-2 locus using CRISPR-Cas9 engineering. Tissue-specific expression of GFP nanobody::ZIF-1 fusion promotes ubiquitylation and subsequent degradation of GFP-tagged gip-2 protein in touch receptor neurons. Touch receptor neurons are red labeled with mKate2. Reference: Development. 2017 Jul 15;144(14):2694-2701. PMID: 28619826.
CZ24274 C. elegans dhc-1(lt45[dhc-1::GFP]) I; ltSi953 II; unc-119(ed3) III. Show Description
ltSi953 [mec-18p::vhhGFP4::ZIF-1::operon-linker::mKate2::tbb-2 3'UTR + Cbr-unc-119(+)] II. GFP tag inserted into the C-terminus of the endogenous dhc-1 locus using CRISPR-Cas9 engineering. Tissue-specific expression of GFP nanobody::ZIF-1 fusion promotes ubiquitylation and subsequent degradation of GFP-tagged dhc-1 protein in touch receptor neurons. Touch receptor neurons are red labeled with mKate2. Reference: Development. 2017 Jul 15;144(14):2694-2701. PMID: 28619826.
CZ3714 C. elegans gcy-31(ok296) X. Show Description
2505bp deletion in cosmid T07D1. Break points are 6562 and 9069 with respect to T07D1. Sequence at the break point is: GGAAAAAAAAACTTCGCG / TTTGGCTAGTCGTAT. Primers: ok296u1: CTGAAACCATCTGACAGA; ok296d1: CATCGGAATAGGATTGTTG; ok296d2: CATTAGGTTTACAGGCTTAG. ok296d1u1 = 290bp product with WT allele. ok296d2u1 = 352 bp product with ok296 allele.
DA2100 C. elegans ser-7(tm1325) X. Show Description
Lack of 5HT stimulation of pumping. Primers GGCCTGCCTTCCTGACATGT, CGCGGATTCTCTATCAATAG, ATCCTG GAGCTGGCGAGTTA, GACTGTAAACGCGCAGAGTC. Mutation site 42634-42635 - GGGAANNAAAACCCTCCCTNNANNANNATNNGCANNCC - 43376-43377. 742 bp deletion + 38 bp insertion.
DCR4521 C. elegans atg-9(ola274[atg-9::gfp]) V. Show Description
This endogenous tag on ATG-9 was made from a CRISPR event that used a method described by Dickinson et al. 2015 to efficiently insert GFP in replace of the stop codon of atg-9. Reference: Stavoe AK, et al. Dev Cell. 2016 Jul 25;38(2):171-85.
DDP1 C. elegans uonEx1. Show Description
uonEx1 [unc-54::alpha-synuclein::CFP + unc-54::alpha-synuclein::YFP(Venus)]. No additional transformation marker was included in the array. uonEx1 also known as SC+SV in reference publications. Reduced lifespan (25-35% lower) and reduced pharyngeal pumping rate compared to N2. Novel transgenic strain for monitoring the influence of genetic and/or environmental factors on the extent of alpha-synuclein aggregation using FRET signals. Because the two fusion proteins are separate, FRET is only possible when synuclein aggregation brings a CFP tag very close to a YFP tag within an aggregate. We suggest using this strain in conjunction with the positive control (high FRET) strain DDP2 or with strain NL5901 which shows opposite changes in FRET. References: Nagarajan A, et al. CNS Neurol Disord Drug Targets. 2015 Aug 21. Bodhicharla R, et al. CNS Neurol Disord Drug Targets. 2012 Dec;11(8):965-75.
DG4392 C. elegans cyb-3(tn1755[gfp::3xflag::cyb-3]) V. Show Description
Although this strain is maintainable as a homozygote it produces many dead embryos (~80%) and has a low viable brood size (~24 ± 18). Thus, the GFP tag compromises CYB-3 function.
DLW109 C. elegans wrdSi23 I; unc-104(knu973[unc-104::AID]) II. Show Description
wrdSi23 [eft-3p::TIR1:F2A:mTagBFP:tbb2 3' UTR:: loxP] I. wrdSi23 is inserted at ttTi4348 (I: -5.32 cM). Pan-somatic expression of TIR1 co-factor for AID, and expression of AID-tagged blue protein in somatic nuclei. Auxin-inducible degradation (AID) tag inserted at C-terminus of endogenous unc-104 locus by CRISPR/Cas9. Can be used for auxin-induced immobilization of worms for live imaging. References: Cahoon CK and Libuda DE. bioRxiv 2021.05.25.445686; doi: https://doi.org/10.1101/2021.05.25.445686. Ashley GE, et al. Genetics. 2021 Mar 31;217(3):iyab006. doi: 10.1093/genetics/iyab006. PMID: 33677541
DLW110 C. elegans wrdSi23 I; unc-18(knu969[unc-18::AID]) X. Show Description
wrdSi23 [eft-3p::TIR1:F2A:mTagBFP:tbb2 3' UTR:: loxP] I. wrdSi23 is inserted at ttTi4348 (I: -5.32 cM). Pan-somatic expression of TIR1 co-factor for AID, and expression of AID-tagged blue protein in somatic nuclei. Auxin-inducible degradation (AID) tag inserted at C-terminus of endogenous unc-18 locus by CRISPR/Cas9. Can be used for auxin-induced immobilization of worms for live imaging. References: Cahoon CK and Libuda DE. bioRxiv 2021.05.25.445686; doi: https://doi.org/10.1101/2021.05.25.445686. Ashley GE, et al. Genetics. 2021 Mar 31;217(3):iyab006. doi: 10.1093/genetics/iyab006. PMID: 33677541
DLW112 C. elegans reSi7 I; unc-104(knu973[unc-104::AID]) II. Show Description
reSi7 [rgef-1p::TIR1::F2A::mTagBFP2::AID*::NLS::tbb-2 3'UTR] (I:-5.32). Neuronal-specific expression of TIR1 co-factor for AID, and tissue-specific AID-tagged blue protein in neuronal nuclei. Auxin-inducible degradation (AID) tag inserted at C-terminus of endogenous unc-104 locus by CRISPR/Cas9. Can be used for auxin-induced immobilization of worms for live imaging. Strain generated by crossing endogenously tagged unc-104::AID into DV3805. reSi7 is at -5.32 cM. References: Cahoon CK and Libuda DE. bioRxiv 2021.05.25.445686; doi: https://doi.org/10.1101/2021.05.25.445686. Ashley GE, et al. Genetics. 2021 Mar 31;217(3):iyab006. doi: 10.1093/genetics/iyab006. PMID: 33677541