| CB6734 |
C. elegans |
clec-60(tm2319) II. Show Description
No obvious phenotype. Reference: O’Rourke et al. (2005) PMID: 16809667.
|
|
| CB6736 |
C. elegans |
clec-61(tm2566) II. Show Description
No obvious phenotype, apparently wildtype sensitivity to pathogens. Reference: O’Rourke et al. (2005) PMID: 16809667.
|
|
| CB6737 |
C. elegans |
clec-69&clec-70(ok2061) IV. Show Description
No obvious phenotype, apparently wild-type sensitivity to pathogens. Derivative of RB1663, further out-crossed into wild-type background. Reference: O’Rourke et al. (2005) PMID: 16809667.
|
|
| CB6772 |
C. elegans |
clec-50(ok2455) V. Show Description
No obvious phenotype, apparently normal sensitivity to bacterial pathogens. Derived from RB1897; further out-crossed into wild-type background. References: O’Rourke et al. (2005) PMID: 16809667. D J O'Rourke and J Hodgkin, unpublished.
|
|
| CV199 |
C. elegans |
fan-1(tm423) IV/nT1 [qIs51] (IV;V). Show Description
Maintain under normal condition. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP fan-1 homozygotes. Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. Reference: Smogorzewska A, et al. (2010) Molec Cell 39:36-47.
|
|
| JDW736 |
C. elegans |
clec-180(wrd281[clec-180::mNG::3xFLAG]) IV. Show Description
Modular linker::mNeonGreen::3xFLAG::linker tag inserted at the C-terminus of the endogenous clec-180 locus by CRISPR. Allele obtained using Cas9 RNP. Cassette design allows for re-editing of locus with common crRNAs/sgRNAs.
|
|
| JIN810 |
C. elegans |
agIs26. Show Description
agIs26 [clec-60p::GFP + myo-2p::mCherry]. mCherry expression in pharynx. GFP expression in posterior gut is upregulated during S. aureus infection and at temperatures >15C. [NOTE: This strain has also been described as AU185 in publications.] Reference: Irazoqui JE, et al. Proc Natl Acad Sci U S A. 2008 Nov 11;105(45):17469-74. (PMID: 18981407)
|
|
| OH18258 |
C. elegans |
pha-1(e2123) III; otIs355; otEx7950. Show Description
otIs355 [rab-3p(prom1)::2xNLS::TagRFP] IV. otEx7950 [clec-166::GFP + pha-1(+)]. Maintain at 25C to select for animals carrying the array. Pan-neuronal nuclear RFP expression. Co-expression of GFP and TagRFP in M5 neuron can be used to isolate M5 by FACS. Used by CeNGEN project for RNA-Seq (https://www.cengen.org/).
|
|
| PHX9026 |
C. elegans |
lat-1(syb9026[lat-1(delta Lec)] *syb8408) II. Show Description
CRISPR/Cas9-engineered deletion of Lectin domain within endogenously-tagged LAT-1A. Internal eGFP and FLAG tags with poly-A linkers inserted into endogenous lat-1 locus before 651 aa. Reduced brood size and high levels of embryonic and larval lethality. Reference: Carmona-Rosas G, et al. bioRxiv 2023.05.04.539414; doi: https://doi.org/10.1101/2023.05.04.539414.
|
|
| PS8544 |
C. elegans |
clec-87(sy1396) I. Show Description
Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of clec-87.
Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette).
left flanking sequence: GTTTTTGCCTTCTCGTTGCTTTCATCCTTCCTGGG
right flanking sequence: CTATTCCTCGTTCATGCAGCTCCGACTTCTTCAAC
inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: GCATGAACGAGGAATAGCCC
Method Reference: G3 (Bethesda).
|
|
| PS8578 |
C. elegans |
clec-88(sy1409) II. Show Description
Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of clec-88.
Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette).
left flanking sequence: TTGGTATGTGCAGTTACTAACGATATTGAAGACGC
right flanking sequence: TAGTGGAGAGACACCTGGAATTGTTTCTCAAATTAC
inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: AACGATATTGAAGACGCTAG
Method Reference: G3 (Bethesda).
|
|
| PS8584 |
C. elegans |
clec-91(sy1415) I. Show Description
Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of clec-91.
Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette).
left flanking sequence: CGACCTACATCCTTATCATCGTCCCACTGATCAT
right flanking sequence: CATTGGAGGCGGTGTCGTCGCTGACAACACAAATG
inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: ATCGTCCCACTGATCATCAT
Method Reference: G3 (Bethesda).
|
|
| PS8825 |
C. elegans |
clec-47(sy1532) V. Show Description
Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of clec-47.
Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette).
left flanking sequence: CTCATTTTTGTACTTGCAATTTTTATATTTCCAATT
right flanking sequence: GCTTCAATTTCGTGTCCAAGTGGCTTTACACTTC
inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: GGACACGAAATTGAAGCAAT
Method Reference: G3 (Bethesda).
|
|
| RB1404 |
C. elegans |
lec-1(ok1597) II. Show Description
W09H1.6a Homozygous. Outer Left Sequence: tttcaggaaccaccgaaaag. Outer Right Sequence: gtagcaaacaaaatgcgggt. Inner Left Sequence: cgaagagccaaagtcctacg. Inner Right Sequence: ggagcatcgttgtttcgttt. Inner Primer PCR Length: 3198. Estimated Deletion Size: about 1500 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| RB1428 |
C. elegans |
lec-3&nlt-1(ok274) II. Show Description
ZK892.1, ZK892.2. Superficially wild type. Outer Left Sequence: GCACCGTATCCCACTCAACT. Outer Right Sequence: GTACCACCAGCTCCGTTCAT. Inner Left Sequence: ATGGGGATGTTGTCCTGAAC. Inner Right Sequence: AAACTTTTGATGGCGGTCAC. Inner Primer WT PCR Product: 3275. Deletion size: 1855 bp. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| RB1660 |
C. elegans |
clec-4(ok2050) II. Show Description
Y38E10A.5. Homozygous. Outer Left Sequence: AGACACGTAAGCTCGGCAGT. Outer Right Sequence: GCAAAGTCGCAGTTTTCTCC. Inner Left Sequence: TATCAATGGCGAGGCACATA. Inner Right Sequence: TACTGCGGCTGAGAAAACCT. Inner Primer PCR Length: 2826 bp. Deletion Size: 1610 bp. Deletion left flank: CTTCTATTTATGTTATTTGTCTTTTGAACT. Deletion right flank: GCAAGTGCCGAAAATTTCCAAAACCAGAAATTGCCGAAATTGCCGATTGCCGGAAATTT TAAAAACAGAC. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| RB1663 |
C. elegans |
clec-69&clec-70(ok2061) IV. Show Description
F56D6.15, Y46C8AL.3. Homozygous. Outer Left Sequence: GTTCACATTTTGGTTTGCCC. Outer Right Sequence: TCCATGTTTCAGGGTGCATA. Inner Left Sequence: CAGTTTGCCCGGACAGTAAT. Inner Right Sequence: ATCTTTGAACCCAGCACCTG. Inner Primer PCR Length: 2991 bp. Deletion Size: 4238 bp. Deletion left flank: TTTTTGCTTCACTTATTTCAAACCTCAAGT. Deletion right flank: GTAATAATTTCAGTCCATTGATATGATGCC. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| RB1701 |
C. elegans |
clec-34(ok2120) V. Show Description
T25E12.8. Homozygous. Outer Left Sequence: AATCCGCTGATCCAACAAAG. Outer Right Sequence: AATTGGTTTGGGCTCAACTG. Inner Left Sequence: TCTCTCAAGAGGGTCGTCGT. Inner Right Sequence: TCAATTTGGTCTCCCTCCAG. Inner Primer PCR Length: 2159 bp. Deletion Size: 1155 bp. Deletion left flank: TCAAATAGGATTACAGGAAAATAATGCGAT. Deletion right flank: CAGAATTCAATGTTCACTAATCAATAGATA. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| RB1745 |
C. elegans |
clec-66(ok2230) II. Show Description
F35C5.9. Homozygous. Outer Left Sequence: GCCTCCAATCGTCATTTGTT. Outer Right Sequence: AAACATTGCCGTTCTGCTTT. Inner Left Sequence: ATAAAAGAGCCTGGCGTGAA. Inner Right Sequence: GAGCCCCTTTTGAAGGCTAT. Inner Primer PCR Length: 2401 bp. Deletion Size: 1187 bp. Deletion left flank: CCTCACCATCCCAAGCAGTCACCGATCGAT. Deletion right flank: TTGCCGATTCGTTTGCCGCGCACCCCTGGT. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| RB1767 |
C. elegans |
clec-39(ok2271) V. Show Description
T25E12.7. Homozygous. Outer Left Sequence: TGGCTGCCTTGCTAGAAAAT. Outer Right Sequence: GTTATTGCACGGGAGACGTT. Inner Left Sequence: GACATTCACACAATCACCGC. Inner Right Sequence: GGGAAAGTGCTCAACTACCG. Inner Primer PCR Length: 2219 bp. Deletion Size: 1334 bp. Deletion left flank: GGTGCCACTCTTTTTTCCATAAAAAGTGAA. Deletion right flank: AATTTTAGAAATTAAAAAAAAAATCACATA. Insertion Sequence: AAATTTTAGAAATTAAAAAAAATTTTAGA. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| RB1803 |
C. elegans |
clec-65(ok2337) II. Show Description
F35C5.8. Homozygous. Outer Left Sequence: TTAATGGTGTTCGGGACCTC. Outer Right Sequence: GGCAAATTTTGACATCGCTT. Inner Left Sequence: AGCAGCATCGCCAACTCTAT. Inner Right Sequence: GCAAATTGCCGGAATTAAAA. Inner Primer PCR Length: 2174 bp. Deletion Size: 1580 bp. Deletion left flank: AACTCTATCCGTCAGTGACAGACGATGCGG. Deletion right flank: GTACTCACTTCTGTGTATTTTTTTTGCTTG. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| RB1870 |
C. elegans |
clec-49(ok2416) V. Show Description
W04D12.6. Homozygous. Outer Left Sequence: ACAGGAACCCCCTGAAAAAT. Outer Right Sequence: TACATCAACTGGGCACCAAA. Inner Left Sequence: AAACCGGAAAATCCTAAGCC. Inner Right Sequence: AATCCGGGAAAGGAAAATTG. Inner Primer PCR Length: 3163 bp. Deletion Size: 1614 bp. Deletion left flank: CGGGTTTTCAATTTCGTGATGTCATTGAAT. Deletion right flank: CCGGCAAATTGGCAAATTGCCGGAATTGAA. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| RB1897 |
C. elegans |
clec-50(ok2455) V. Show Description
W04E12.8. Homozygous. Outer Left Sequence: AGTTGTTCGCATCCCTTTTG. Outer Right Sequence: ACACAACCCGGACACCTTTA. Inner Left Sequence: CAAAACCCCTGGATCAACTG. Inner Right Sequence: CATGCTTCTCGCACATTTTG. Inner Primer PCR Length: 3140 bp. Deletion Size: 1880 bp. Deletion left flank: CCTGACCGACCTTGTGCATACCGATCCACG. Deletion right flank: GTGATAACGTTAAAGAATGGTGCCATATAG. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| RB1898 |
C. elegans |
clec-50(ok2456) V. Show Description
W04E12.8. Homozygous. Outer Left Sequence: AGTTGTTCGCATCCCTTTTG. Outer Right Sequence: ACACAACCCGGACACCTTTA. Inner Left Sequence: CAAAACCCCTGGATCAACTG. Inner Right Sequence: CATGCTTCTCGCACATTTTG. Inner Primer PCR Length: 3140 bp. Deletion Size: 1387 bp. Deletion left flank: AGGCAGTTGTTTGGAGCGGCCGACACGTTC. Deletion right flank: AATTTTTATCACACAGTTTTTGTTTTAATT. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| RB1953 |
C. elegans |
lec-7(ok2569) X. Show Description
R07B1.2 Homozygous. Outer Left Sequence: accctaaacgacattcgcac. Outer Right Sequence: aactatgcatgtgcatccca. Inner Left Sequence: aaacatctcaaaaatgcccg. Inner Right Sequence: gctcacgctaccatttcctc. Inner Primer PCR Length: 2100. Deletion size: about 1000 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| RB1984 |
C. elegans |
clec-227(ok2618) V. Show Description
F08H9.5. Homozygous. Outer Left Sequence: TTATCCGGACAATCCGTAGC. Outer Right Sequence: AAAGCAATCCGGTCAATACG. Inner Left Sequence: ACTTCAATACACCGGATGGC. Inner Right Sequence: ACTTTGTGCCAGCCAACTTT. Inner Primer PCR Length: 2163 bp. Deletion Size: 1295 bp. Deletion left flank: TTATAAAAGAAAAATTGTATTTTTTTGAAA. Deletion right flank: TTTATTATGTGAATGCTCCAACTGGATTCC. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| RB2004 |
C. elegans |
clec-63(ok2656) II. Show Description
F35C5.6. Homozygous. Outer Left Sequence: ACACCCATCAGTCCTTCCTG. Outer Right Sequence: ACCAAAACATGCCTACCTGC. Inner Left Sequence: GGTGTTATCAGTGATGGGGG. Inner Right Sequence: TACCCCAGATATGTCCGAGC. Inner Primer PCR Length: 2202 bp. Deletion Size: 823 bp. Deletion left flank: AATTTCTGAAGATCAGACAAAAATAGAGAG. Deletion right flank: TTGGATGGCAGAACATCAACGCATACAGTG. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| RB2274 |
C. elegans |
clec-106&Y18D10A.23(ok3084) I. Show Description
Y18D10A.12, Y18D10A.23. Homozygous. Outer Left Sequence: ACCACGACTGGGAAGTTCAG. Outer Right Sequence: GCCTAACATCTGCCTTCTCG. Inner Left Sequence: ACTGGATTCTAGGCCCACG. Inner Right Sequence: GTTGCTCCATGCTACGTGAA. Inner Primer PCR Length: 1318 bp. Deletion Size: 719 bp. Deletion left flank: TTCTTCCGCCAACCCATACCTCGGCTGTTC. Deletion right flank: AATGCTCCGCAACAATGCAACGATCCACCC. Insertion Sequence: GCTTGA. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| RB2326 |
C. elegans |
clec-230(ok3158) V. Show Description
C29F3.5. Homozygous. Outer Left Sequence: CGTTCAACTCACCAGATCCA. Outer Right Sequence: TTCGCGCCAAGTCTAATTTT. Inner Left Sequence: CTGCCCAGTCAAAATCACATT. Inner Right Sequence: AGGAGTGATGGACCAATTTTT. Inner Primer PCR Length: 1299 bp. Deletion Size: 367 bp. Deletion left flank: GTCAGCGGCCTTTAAGATTTCTAGCATTTG. Deletion right flank: TTGTCATTGGAGACACCGTTTTGCCAGACG. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| RB2345 |
C. elegans |
clec-29(ok3181) V. Show Description
T25E12.9. Homozygous. Outer Left Sequence: CTGGAGGGAGACCAAATTGA. Outer Right Sequence: ATTTTCTAGCAAGGCAGCCA. Inner Left Sequence: TGCAAATGAACCAACTCCTG. Inner Right Sequence: CTGCAAACCATGACAACTTCA. Inner Primer PCR Length: 1140 bp. Deletion Size: 549 bp. Deletion left flank: AGAGTGTCAGCACGAATCGGTTCTCGTTTC. Deletion right flank: GTGTAGATCCACCGAGGTTCATGCAAGCCT. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| RB2350 |
C. elegans |
clec-43(ok3188) II. Show Description
R07C3.1. Homozygous. Outer Left Sequence: ATGCAAGTTATGTGTGCGGA. Outer Right Sequence: GTTATTTGGAGAGGCTGCCA. Inner Left Sequence: TTTTGTGGGCCTGAGTTTTT. Inner Right Sequence: GCCGCATTATACATTCGGATA. Inner Primer PCR Length: 1270 bp. Deletion Size: 706 bp. Deletion left flank: TCCTCAGATGGAGATTATTCCTACTACAGC. Deletion right flank: ATAAGATCTATAACTCTACTACAAATGTGT. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| RG3129 |
C. elegans |
clec-178(ve629[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) IV. Show Description
homozygous viable. Deletion of 954 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: tgtacttacgcaataggtatattccctaaa ; Right flanking sequence: gtaggataggttttactgtcagaagcttcg. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| RG3294 |
C. elegans |
clec-57(ve794[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) V. Show Description
Homozygous viable. Deletion of 1424bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: TGATTCTTCTCCCCATTTTCCTGCTTTTCA ; Right flanking sequence: GGGGATTTGAATCGTCTACAAACATGATGA. clec-57 crRNA A: GCATTATTGGACTTTCAGgt; clec-57 crRNA B: ATCTTCATACAATTTGGCTC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| RG3422 |
C. elegans |
clec-86(ve922[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) X. Show Description
Homozygous viable. Deletion of 512 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: cttgtcgcgcttttgtgttttgtgtCACCA ; Right flanking sequence: CCCACCATGTCCATCTTGTTCTAAATAACT. clec-86 sgRNA A: GTATCTCCAGGAAGACAATT; clec-86 sgRNA B: CATGTGTACGATCCTCCAGT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| RG3424 |
C. elegans |
clec-53(ve924[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) I. Show Description
Homozygous viable. Deletion of 1852 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: ATTTAGTGAAGTGGAGCAATTTTACAAAGG ; Right flanking sequence: AGTGGTCGGAGCATTTGACTCGACTACTGC. clec-53 sgRNA A: AAAGCTCTTTGATCGTCTTG; clec-53 sgRNA B: GATTCTTGCTCTGTGCCTTG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| SAL146 |
C. elegans |
pha-1(e2123) III; denEx24. Show Description
denEx24 [clec-85p::GFP + pha-1(+)]. Maintain at >22 degrees. Reference: Alper S, et al. (2007) Mol Cell Biol 27:5544-53.
|
|
| VC1954 |
C. elegans |
clec-68&clec-69(ok2549) IV. Show Description
F56D6.15, F56D6.1. External left primer: GTCTCGATTTGGTAGCAGGC. External right primer: AGACTGTGTGCCACCTGATG. Internal left primer: TGCACTCCAAGGATAGTCCC. Internal right primer: GGGCTGCTGTAGAAGGTCTG. Internal WT amplicon: 3106 bp. Deletion size: 2663 bp. Deletion left flank: TTTCAAACATCGTCTCAAAAGTCCGCAAGT. Deletion right flank: TTTTCTCAACTGATTTTGCATGGTTAAGTG. Insertion Sequence: TTCTCAACTGAT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| VC2345 |
C. elegans |
clec-106&Y18D10A.23(ok3090) I. Show Description
Y18D10A.12, Y18D10A.23. External left primer: ACCACGACTGGGAAGTTCAG. External right primer: GCCTAACATCTGCCTTCTCG. Internal left primer: ACTGGATTCTAGGCCCACG. Internal right primer: GTTGCTCCATGCTACGTGAA. Internal WT amplicon: 1318 bp. Deletion size: 724 bp. Deletion left flank: CCTCCGTTTTGGTTTATGATATCGCGGAAG. Deletion right flank: TGCTCTTGAACCCGTCTCTGAACCAATTCA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| VC2919 |
C. elegans |
clec-198(gk3149) IV; W03G11.3(gk1251) X. Show Description
C49C3.13, W03G11.3. The gk1251 allele was identified by PCR and validated by CGH, and can be detected with PCR using the following primers. External left primer: AATGGAAAACGTTTGAACTTTGTAG. External right primer: AATTCAATCCATCATTTTCTGTGTT. Internal left primer: CATTGCCAAAAGGTGTCATAAA. Internal right primer: CCATCTTGGTACGATGACTCAA. Internal WT amplicon: 2027 bp. Deletion size: 969 bp. Deletion left flank: TATGATACAATGACTAAATATCGTAATCAG. Deletion right flank: TCCCCAATGACAGAATATGCCAAACTTTGA. The gk3149 allele was identified by CGH. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| VC3027 |
C. elegans |
clec-70(ok3725) IV. Show Description
Y46C8AL.3. External left primer: AAAAACCCTGACCAAAGGCT. External right primer: AATCGCATGGTTACGCAAAT. Internal left primer: AGACTGACATCCCACAAGCA. Internal right primer: ATTCGGAATCAGGGGAAAAT. Internal WT amplicon: 1151 bp. Deletion size: 507 bp. Deletion left flank: TTCATTGCTTCCAATACACCATCCGGCGGC. Deletion right flank: TGCTAATCTTGATGCTTCCGGTTTCGCTAT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| VC3965 |
C. elegans |
clec-118(gk5049) C17C3.3(gk5048) II. Show Description
Homozygous viable. Nonsense allele and splicing defect identified by amplicon sequencing.
|
|
| VC4119 |
C. elegans |
clec-199(gk5198) IV. Show Description
Homozygous viable. Splicing allele identified by amplicon sequencing. The gk5198 mutation is G->A, flanking sequences AATTAAAAAATGTTTAATACCACCTATTCA and ACAGCAAAAACTACAAAGTCCACGACAACC.
|
|
| VC4156 |
C. elegans |
R12C12.6(gk5239) II; clec-56(gk5240) V. Show Description
Homozygous viable. Nonsense alleles identified by amplicon sequencing. The gk5239 mutation is A->T, flanking sequences AAATTTTAAAAGACTCGGACAAATGCATCG and CATCGTGTATCTTCGAAGTTAGCCTGAAAA. The gk5240 mutation is G->A, flanking sequences ATGCTGACACCAATCACTGCCCTCTTGGAT and GACCTTCTCCACCAATACTTCTTACTGTTA.
|
|
| VC4181 |
C. elegans |
clec-91(gk5267) I. Show Description
Homozygous viable. Nonsense allele identified by amplicon sequencing. The gk5267 mutation is C->T, flanking sequences AATGCGCTGGTGCCAAGATCCTTGTGGTCC and AGTTGTAGTATGTCACTGTAAGATTGATTA.
|
|
| VC4391 |
C. elegans |
clec-266(gk5469[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) X. Show Description
Homozygous viable. Deletion of 1198 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: CGCAGATCGAGTAGAACTTGAAAGAGCATG. Right flanking sequence: AGCACTTCAAAAGTTTCGAGTGTTTTATTG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| VC4809 |
C. elegans |
clec-199(gk5877[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) IV. Show Description
Homozygous viable. Deletion of 5972 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Please refer to supporting documents linked to the strain name in the CGC Strain Information display. Left flanking sequence: GTAGTTCCGTTCTGACAGTTCTTTGTTAAG. Right flanking sequence: TGGCGCAACGAGGAACTTGGAGACCTTATG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| VC4840 |
C. elegans |
clec-207(gk5908[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) V. Show Description
Homozygous viable. Deletion of 1278 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break. Please refer to supporting documents linked to the strain name in the CGC Strain Information display. Left flanking sequence: ATTATTTTCCCGATCTCCATATAAAAACCG. Right flanking sequence: ACGAAAATTTGTTGTTTAAAAAAACTTGTA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| YY11 |
C. elegans |
dcr-1(mg375) III. Show Description
Enhanced RNAi. Sterile at 25 degrees. Referenced in Pavelec et al. Genetics (2009).
|
|
| YY13 |
C. elegans |
rrf-3(mg373) II; oxls12. Show Description
oxls12 [unc-47p::GFP + lin-15(+)]. Enhanced RNAi. Sterile at 25 degrees. [NOTE: the genotype of YY13 as previously annotated only as rrf-3(mg373)] References: Pavelec DM, et al. Genetics. 2009 Dec;183(4):1283-95. PMID: 19797044. McIntire SL, et al. Nature. 1997 Oct 23;389(6653):870-6. PMID: 9349821.
|
|
| YY166 |
C. elegans |
ergo-1(gg98) V. Show Description
Enhanced RNAi. Isolated in lin-15B RNAi screen. Referenced in Pavelec et al. Genetics (2009).
|
|