Search Strains

More Fields
Strain Species Genotype Add
APL31 C. elegans lin-12(ljf31[lin-12::mNeonGreen[C1]::3xFLAG]) III. Show Description
mNG and 3xFLAG tags fused to the C-terminal end of the intracellular domain of the endogenous lin-12 locus using a 9 amino acid flexible linker. Reference: Pani AM, et al. A new toolkit to visualize and perturb endogenous LIN-12/Notch signaling in C. elegans. MicroPubl Biol. 2022 Jul 28;2022:10.17912/micropub.biology.000603. doi: 10.17912/micropub.biology.000603. PMID: 35966394.
APL5 C. elegans ljfSi2 I. Show Description
ljfSi2 [hlh-8p::2x mKate2::D. melanogaster moesin actin-binding domain::SL2::2x mTurquoise2::PH::3xHA::tbb-2 3'UTR loxN] I. Single-copy transgenic strain that expressing mTurquoise2::PH plasma membrane marker and mKate2::moesin actin binding domain in the M lineage. lfjSi2 was inserted at Chr I:2851088, near ttTi4348, using Cas9-triggered homologous recombination. Reference: Gibney TV & Pani AM. Development. 2025 Aug 21:dev.204802. doi: 10.1242/dev.204802. PMID: 40838367.
APL622 C. elegans ljfSi2 I; ljfSi39 IV; egl-17(ljf7[egl-17::mNG::3xFlag]) X. Show Description
ljfSi2 [hlh-8p::2x mKate2::D. melanogaster moesin actin-binding domain::SL2::2x mTurquoise2::PH::3xHA::tbb-2 3'UTR loxN] I. ljfSi39 [myo-3p::egl-15(5a)::SL2::2x mKate2::PH::3xHA::tbb-2 3' UTR lox511i] IV. mNeonGreen::3xFlag tag inserted at the C-terminus of the endogenous egl-17. EGL-15(5a) expression in body wall muscle cells captures free EGL-17, reducing long-range signaling and causing moderately penetrant sex myoblast migration defects. ljfSi2 is a single copy transgene inserted at Chr I:2851088 near ttTi4348 using Cas9-triggered homologous recombination. ljfSi39 is a single copy transgene inserted at Chr IV:4237723 using Cas9-triggered homologous recombination. Reference: Gibney TV & Pani AM. Development. 2025 Aug 21:dev.204802. doi: 10.1242/dev.204802. PMID: 40838367.
AUM1535 C. elegans drsh-1(viz43)/tmC18[dpy-5(tmIs1200[myo-2p::mVenus])] I. Show Description
[D943G] substitution mutation in conserved residue within RNAse III domain. Balancer marked with myo-2p::Venus. Pick fertile wild-type (non-Dpy) Venus+ to maintain. drsh-1(viz43) homozygous animals display heterochronic phenotypes beginning at L3/L4 molt and typically burst at the vulva in L4. Heterozygotes are wild-type with pharyngeal Venus fluorescence, and segregate Venus+ heterozygotes, non-Venus viz-43 homozygotes, and Dpy Venus+ tmC18 homozygotes. Reference: Barish S, et al. Human Mol Genet. 2022 Aug 25;31(17):2934-2950. doi: 10.1093/hmg/ddac085. PMID: 35405010.
AUM1747 C. elegans prg-1(viz142[V5::mCherry::GSIGSLRSI::prg-1] viz146[PAZ deletion]) I. Show Description
282bp deletion (247aa-345aa) in PAZ domain of endogenously-tagged prg-1 locus. V5 epitope and mCherry tags with a flexible linker inserted after the first 18 nt of the coding sequence of endogneous prg-1 locus. mCherry tagged PRG-1 primarily expressed and localized in both hermaphrodite and male gonad. Reference: Ortega J, et al. Sci. Adv.10,eadp0466(2024).DOI:10.1126/sciadv.adp0466 https://www.science.org/doi/10.1126/sciadv.adp0466 PMID: 39356768.
BK600 C. elegans exc-9(qp128[gfp::3xflag::exc-9(*LIM)] *qp124) IV. Show Description
2nd, 3rd, and 4th Cysteines in EXC-9 LIM domain replaced with Alanines in endogenoulsy-tagged exc-9 locus. Canals slightly shortened. Derived by further CRISPR modification of qp124. Reference: Yang Z, et al. J Cell Biol. 2020 Nov 2;219(11):e202003152. doi: 10.1083/jcb.202003152. PMID: 32860501.
BP75 C. elegans eff-1(hy21) II. Show Description
Temperature sensitive. Cell fusion-defective embryos, larvae and adults at 25C. Cell fusion defects are less penetrant at 15C. Egl, Unv, Pvl, Dpy and 2% Muv at 20C and 25C. Mutants have body morphological defects and bulged tails at all temperatures, male tails are leptoderan. Partial sterility of hermaphrodites: brood size is 48 at 25C. sd-4%. ME=0. ES=3. OA-1 (oj55: complete embryonic and partial post-embryonic epithelial fusion failure). Cloned: encodes a type-I membrane glycoprotein with a single TM domain.
BP76 C. elegans eff-1(hy21) II; jcIs1 IV. Show Description
jcIs1 [ajm-1::GFP + unc-29(+) + rol-6(su1006)] IV. Temperature sensitive. Cell fusion-defective embryos, larvae and adults at 25C. Cell fusion defects are less penetrant at 15C. Egl, Unv, Pvl, Dpy and 2% Muv at 20C and 25C. Mutants have body morphological defects and bulged tails at all temperature, male tails are leptoderan. Partial sterility of hermaphrodites: brood size is 48 at 25C. ME=0. Cloned: ORF C26D10.5 encodes a type-I membrane glycoprotein with a single TM domain. ajm-1 was formerly known as jam-1 (Junction Associated Protein) and "the gene encoding the antigen recognized by the monoclonal antibody MH27." jcIs1 consists of pJS191, C45D3 and pRF4. Reference: Mohler WA, et al. Curr Biol. 1998 Sep 24;8(19):1087-90.
BU8041 C. elegans pat-3(kq8041) III. Show Description
Mild motility and gonad migration defects. pat-3(kq8041) is an engineered Y804A substitution of the membrane distal tyrosine in the cytoplasmic domain. Reference: Hanna J, et al., microPublication Biology. 10.17912/micropub.biology.000291. https://www.micropublication.org/journals/biology/micropub-biology-000291
BU8042 C. elegans pat-3(kq8042) III. Show Description
Motility and cell (DTC) migration defects. pat-3(kq8042) is an engineered Y804E substitution of the membrane distal tyrosine in the cytoplasmic domain. Reference: Hanna J, et al., microPublication Biology. 10.17912/micropub.biology.000291. https://www.micropublication.org/journals/biology/micropub-biology-000291
BU8043 C. elegans pat-3(kq8043) III. Show Description
Mild motility and cell migration defects. pat-3(kq8043) is an engineered Y804F substitution of the membrane distal tyrosine in the cytoplasmic domain. Reference: Hanna J, et al., microPublication Biology. 10.17912/micropub.biology.000291. https://www.micropublication.org/journals/biology/micropub-biology-000291
CH120 C. elegans cle-1(cg120) I. Show Description
Homozygous viable and fertile. Partially penetrant Egl and cell/axon guidance defects. Deletion of nucleotides 22756-24758 based on cosmid F39H11 sequence (Genbank AF164959). Results in loss of carboxyl NC1 domain from CLE-1.
COP1622 C. elegans nas-38(knu568) X. Show Description
Increased movement quiescence during lethargus. knu568 is a specific in-frame deletion of the TSP1 domain. Reference: Sinner MP, et al. Curr Biol. 2021 Feb 8;31(3):564-577.e12. PMID: 33259791
COP1635 C. elegans nas-38(knu579 ok3407) X. Show Description
Specific in-frame deletion of the astacin domain in ok3407 background suppresses increased quiescence from the ok3407 allele. Quiescence behavior in this strain is reverted to wild-type. Reference: Sinner MP, et al. Curr Biol. 2021 Feb 8;31(3):564-577.e12. PMID: 33259791
COP2772 C. elegans oma-1(knu1284[delta TZF])::GFP IV; oma-2(ne5034[AID*::oma-2] neSi101 V. Show Description
knu1284 is a CRISPR-engineered in-frame deletion of the TZF domain of oma-1. AID* degron tag (IAA17) inserted into the endogenous oma-2 locus. When OMA-2 is present, this mutant does not appear to have obvious phenotypes. Auxin-inducible depletion of OMA-2 causes a null phenotype: animals do not produce mature embryos and have an empty uterus. Reference: Ertekin A, et al. bioRxiv. 2025 May 12:2025.05.09.653132. doi: 10.1101/2025.05.09.653132. PMiD: 40463014.
CVB96 C. elegans siss-1(csn20) IV. Show Description
siss-1(csn20) animals are defective in stress-induced sleep (SIS) with no other obvious defects in development or behavior. csn20 is a Cys-to-Tyr substitution in the third Cys residue of the EGF motif of SISS-1 (a.k.a. IGEG-1). csn20 phenocopies the deletion allele ve532, indicating that the EGF domain of SISS-1 is functional. Reference: Hill AJ, et al. Nat Commun 15, 10886. doi: 10.1038/s41467-024-55252-4. PMID: 39738055.
CX5893 C. elegans kyIs140 I; ceh-36(ky646) X. Show Description
kyIs140 [str-2::GFP + lin-15(+)] I. In ceh-36 mutants, both AWC cells fail to take on the AWC fate. ceh-36 is also required for the specification of the ASEL identity. ceh-36 encodes a member of the OTX/OTD family of homeodomain proteins. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
CX5922 C. elegans kyIs140 I; ceh-36(ky640) X. Show Description
kyIs140 [str-2::GFP + lin-15(+)] I. In ceh-26 mutants, both AWC cells fail to take on the AWC fate. ceh-36 is also required for the specification of the ASEL identity. ceh-36 encodes a member of the OTX/OTD family of homeodomain proteins. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
CZ25708 C. elegans prg-1(ju1574) I. Show Description
Temperature sensitive sterility: maintain at 15-20C. prg-1(ju1574) mutant animals become sterile at the fifth generation grown at 25C. prg-1(ju1574) contains two mutations in the PIWI domain active site (RNaseH/slicer) [D583A, Y585A]. Mutation of the first conserved aspartate of the catalytic triad (D-D-H motif) to alanine (D583A) created an A-D-H motif which abolishes slicer activity in Argonaute proteins. WT: [GTCGGCTACGATCTGTACCACGACTCGACATTGAAAGGAAAAACT --> VGYDLYHDSTLKGKT] ju1574: [GTCGGCTACGcgCTGgctCAtGAtTCGACATTGAAAGGAAAAACT --> CGYALAHDSTLKGKT] Forward genotyping primer: GTAATGCTCGCTGACGACAA Reverse genotyping primer: TTGACGAACTGTGGAACCAA Reference: Kim KW, et al. Neuron. 2018 Feb 7;97(3):511-519.e6. doi: 10.1016/j.neuron.2018.01.014.
DE90 C. elegans oxIs318 II; unc-119(ed3 or e2498) ruIs32 III; ddIs6 V; dnIs17. Show Description
oxIs318 [spe-11p::mCherry::histone + unc-119(+)] II. ruIs32 [pie-1p::GFP::histone H2B + unc-119(+)] III. ddIs6 [tbg-1::GFP + unc-119(+)] V. dnIs17 [pie-1p::GFP::hPLCIII?PH domain + unc-119(+)]. Maintain under normal conditions. Pick GFP+ to maintain. Reference: Johnston et al. (2010) Curr Biol.
DM1602 C. elegans hsp-1(ra807) IV; unc-23(e25) V. Show Description
Superficially wild-type. Temperature-sensistive. Maintain at 15C. hsp-1(ra807) is a missense allele that replaces the conserved Ala379 residue to a Val residue in the ATPase domain of the HSP-1 protein and fully suppresses the bent-head phenotype of unc-23(e25). Animals are sterile or arrest development as larvae at when grown at 20-25C. Reference: Rahmani P, Rogalski T, Moerman DG. (2015) Worm. In press.
DM2407 C. elegans hsp-1(ra807) IV; dpy-11(e224) V. Show Description
Dpy. hsp-1(ra807) is a missense allele that replaces the conserved Ala379 residue to a Val residue in the ATPase domain of the HSP-1 protein and fully suppresses the bent-head phenotype of unc-23(e25). Reference: Rahmani P, Rogalski T, Moerman DG. (2015) Worm. In press.
DMS1983 C. elegans dmaEx620. Show Description
dmaEx620 [rpl-28p::fshr-1(ECD)::mCherry + unc-54p::GFP]. Pick GFP+ animals to maintain. Extrachromosomal mCherry?tagged FSHR?1 extracellular domain reporter. Reference: Wang C, et al. Aging Cell. 2023 Jan;22(1):e13735. doi: 10.1111/acel.13735. PMID: 36415159.
DR1566 C. elegans daf-2(m579) III. Show Description
Adults Age and Itt and temperature sensitive Unc (class 2 allele). m579 results in an amino acid substitution(R437C) in the extracellular portion of the DAF-2 receptor (specifically, the Cys-rich domain).
DR1942 C. elegans daf-2(e979) III. Show Description
This strain forms 20% dauers at 15C. At 25C there occurs about 25% embryonic arrest and about 75% L1 arrest. The e979 mutation results in an amino acid substitution, C146Y, in the ligand-binding domain of the DAF-2 receptor. [CGC received new stock of DR1942 September 2002. Previous stock was probably m41 and not e979.] [June 2004: Patrice Albert has confirmed the mutation in this stock: Repeat of sequencing for CGC collection strain DR1942 [daf-2(e979)] is complete. The strain does carry a C146Y mutation (coding strand TGC to TAC) [Mutation position is at 143, not 146, based on the amino acid sequence shown in Wormbase for daf-2. It's the C in partial sequence EKRCGPI of Exon 5.].]
DR608 C. elegans daf-2(m212) III. Show Description
Temperature sensitive Daf-c. Maintain at 15C. Adults Age and Itt, but not Unc (severe class 1 allele). m212 results in an amino acid substitution(C883Y) in the extracellular portion of the DAF-2 receptor (specificaly, the FnIII2ID domain).
EG9631 C. elegans unc-13(s69) I. Show Description
Aldicarb resistant. This allele is a small exonic deletion that frameshifts exon 21, thus deleting the MUN domain of both long and short isoforms of unc-13. The reference allele e51 is R471-stop, affecting only UNC-13L. Derived by 2x outcross of BC168. Reference: Rose AM & Baillie DL. Genetics. 1980 Nov;96(3):639-48.
EM347 C. elegans tlp-1(bx85) IV; him-5(e1490) V. Show Description
Although hermaphrodites appear WT in other ways, there are some problems with T cell lineages (affecting the phasmids) and tail cell fusions. Variably Dyf. Male tail tip morphogenesis is also defective, resulting in blobby, "leptoderan" tails. Males are infertile due to an inability to properly copulate. tlp-1 encodes a nuclear protein with a single C2H2-type zinc finger domain and an N-terminal "SPLALLA" domain, similar to that of Sp1 transcription factors of vertebrates. The bx85 mutation involves a truncation of TLP-1 due to a frameshift caused by a 5-bp deletion.
EU1590 C. elegans zyg-12(or577) II. Show Description
Recessive, temperature-sensitive embryonic lethal mutant . Maintain at 15C, most embryos will hatch. Nearly all embryos fail to hatch at 25C. Centrosomes are detached from nuclear spindle envelope in one-cell stage embryos; sometimes reattach to pronuclei; sometimes stay unattached throughout prophase until nuclear envelope breakdown. Mis-sense mutation in Q367P. Hook family member. Localizes to nuclear envelope and centrosomes; interacts with SUN domain proteins at nuclear envelope and interacts with dynein.
FK163 C. elegans cam-1(ks52) II. Show Description
Deletion of the tyrosine kinase domain of kin-8. Partial Daf-c especially on an old lawn of E. coli. Reduced daf-7 expression in ASI. Dye-filling defective in ASI. Abnormal ASI cell position. 10-20% of animals show withered (Wit) tail phenotype or defects in elongation or migration of posterior gonad. Previously called kin-8.
FT1568 C. elegans unc-119(ed3) III; xnIs371; xnEx384. Show Description
xnIs371 [pie-1p::GFP::pac-1(1-574) + unc-119(+)]. xnEx384 [hsp16p::HA::phplc1(delta)1::hmr-1(ICD) + rol-6(su1006)]. Rollers. Rollers express HMR-1 intracellular domain pan-cortically in cells upon heat shock. Maintain at 15C or 20C to prevent leaky expression of heat shock transgene. Reference: Klompstra D, et al. Nat Cell Biol. 2015 Jun;17(6):726-35.
FT1569 C. elegans unc-119(ed3) III; xnIs371; xnEx385. Show Description
xnIs371 [pie-1p::GFP::pac-1(1-574) + unc-119(+)]. xnEx385 [hsp16p::HA::phplc1(delta)1::hmr-1(ICD-M) + rol-6(su1006)]. Rollers. Rollers express mutated HMR-1 intracellular domain (unable to bind catenins) pan-cortically in cells upon heat shock. Maintain at 15C or 20C to prevent leaky expression of heat shock transgene. Reference: Klompstra D, et al. Nat Cell Biol. 2015 Jun;17(6):726-35.
HP17 C. elegans sos-1(pd10) V. Show Description
sos-1 gain-of-function allele originally isolated as a suppressor of sem-5(n1619) lethality. pd10 causes a E99K substitution within the N-terminal histone fold domain of SOS-1. Single mutants appear wild-type.
IB16 C. elegans ceh-17(np1) I. Show Description
WT behavioral phenotype. Axon guidance defect in ceh-17 expressing neurons ALA and 4SIA. ceh-17 = D1007.1, a C. elegans paired homeodomain transcription factor, Phox2 orthologue. np1 is a molecular null. np1 is a 1353 bp deletion inculding 549 bp upstream of the initiator ATG and extending to the 5th codon of the homeodomain. [NOTE: Miyazaki, et al. (2022) report that this strain carries the fln-2(ot611) mutation in the background, and outcrossing the strain resulted in significantly reduced quiescence during lethargus.]
JH3619 C.elegans par-1(ax4208[meGFP::delta-KA1]) V/nT1[qIs51] (IV;V). Show Description
qIs51 [myo-2p::GFP + pes-10p::GFP + F22B7.9p::GFP]. Heterozygotes are wild-type GFP+ and segregate non-GFP par-1 homozygotes (viable, lay viable progeny that are completely sterile), wild-type GFP+ heterozygotes, and arrested nT1[qIs51] aneuploids. Pick wild-type GFP+ and check for correct segregation of progeny to maintain. par-1(ax4208) removes the KA1 domain from a GFP-tagged version of PAR-1. Reference: Folkman AW & Seydoux G. Development. 2019 Mar 25;146(6):dev171116. doi: 10.1242/dev.171116. PMID: 30814118
JH4012 C. elegans gtbp-1(ax4561[gtbp-1p::IBB domain::mNeonGreen::gtbp-1 3'utr]) IV. Show Description
The Importin Beta Binding domain (IBB)::mNeonGreen reporter replaces gtbp-1 in the endogenous gtbp-1 locus. Sterile at 25C; maintain at 20C. Reference: Thomas et al. 2022. Cytoplasmic nucleoporin foci are stress-sensitive, non-essential condensates in C. elegans
JK590 C. elegans glp-1(q35)/eT1 III; him-5(e1490)/eT1 V. Show Description
Heterozygotes are wild-type and segregate wild-type heterozygotes, glp-1(q35) homozygotes (Muv steriles), eT1 homozygotes (Unc-36), and males. glp-1(q35) has a semi-dominant multi-vulva phenotype as well as the loss-of-function Glp phenotype (sterility and embryonic lethality). The q35 mutation is a nonsense mutation that eliminates 122 C-terminal amino acids including a PEST sequence. The C terminus was thought to contain a negative regulatory domain that inactivates glp-1 in the VPCs; the inappropriate glp-1(q35) activity can substitute for lin-12 vulval fate determination. References: Austin J & Kimble J. Cell. 1987 Nov 20;51(4):589-99. Mango S, et al. Nature. 1991 Aug 29;352(6338):811-5.
JK6011 C. elegans lst-1(q1032[*q1004]) I. Show Description
q1004[LST-1::3xV5] is the CRISPR-engineered insertion of a 3xV5 tag at the C-terminus of the endogenous lst-1 locus. q1032 is the CRISPR-engineered mutation C260S & C263S in the Zn finger domain of LST-1 (Haupt et al., 2019) in the q1004 background. Reference: Haupt KA, et al. Development. 2019 Oct 17;146(20):dev181644. doi: 10.1242/dev.181644. PMID: 31515205.
JPS360 C. elegans slo-1(js379)V; vxEx360. Show Description
vxEx360 [slo-1p::slo-1(D391/396A)::mCherry::unc-54 3'UTR + myo-2p::mCherry]. Pick animals with mCherry expression in the pharynx to maintain the array. Partially crooked neck phenotype. vxEx360 expresses worm BK channel protein (slo-1(D391/396A)) with purported calcium-sensing residues in the RCK1 domain compromised and a C-terminal mCherry tag. Reference: Davis SJ, Scott LL, Hu K & Pierce-Shimomura JT. J Neurosci. 2014 Jul 16;34(29):9562-73.
JT193 C. elegans daf-2(sa193) III. Show Description
Adults Age and Itt, but not Unc (class 1 allele). sa193 results in an amino acid substitution(A580T) in the extracellular portion of the DAF-2 receptor (specifically, the L2 domain).
KG4731 C. elegans unc-116(ce815[LoxP+sup-1(e995)+LoxP]) III. Show Description
Lox P sites in 3' UTR and 4th intron flank kinesin motor domain sequences; sup-1(e995) mini-gene inserted in second intron. Appears wild-type on plates and in quantitative locomotion assays. Can be used to conditionally delete gene sequences encoding the conventional kinesin motor domain in a tissue specific manner by driving expression of Cre recombinase in the tissue of interest. Reference: Stec N, et al. (Submitted). An Intron Compatible Marker for Long Distance CRISPR Mediated Gene Editing in Caenorhabditis elegans.
KG532 C. elegans kin-2(ce179) X. Show Description
Adults generally short, although some can reach near normal length. Slow growth rate. Backing can be loopy, but does not like to back. Strongly hypersensitive to stimuli. Relatively constant spontaneous movement. Some clustering especially in response to stimuli. Mature adults have vulval bump. Most young adults are Egl-c and young embryos can be found on the plate. Some mature adults become moderately Egl-d. Recessive allele. Males are small and slow growing. Mutation is R92C, which is a conserved residue in the 10 amino acid inhibitory domain that normally functions to keep protein kinase A turned off in the absence of cAMP. Population tends to severely crash within 2-3 weeks of starvation.
KG744 C. elegans pde-4(ce268) II. Show Description
Hyperactive locomotion and hypersensitive to stimuli such as plate dropping. Restores wild type levels of locomotion to paralyzed ric-8(md303) mutants. Most, but not all adults, appear significantly Egl-c. Some mature adults are thinner than normal. Aldicarb sensitivity, growth rate, pumping, length, and distribution on food are all similar to wild type. The ce268 mutation is a D448N change relative to PDE-4D isoform. It disrupts the catalytic domain by changing one of the four active site residues that together chelate an active site zinc atom. Inheritance is semi-dominant due to dominant negative side effects.
KM48 C. elegans +/szT1 [lon-2(e678)] I; cdk-4(gv3)/szT1 X. Show Description
745 bp deletion of cdk-4 from intron I to exon3 removing putative ATP binding domain and catalytic residues. Most homozygous animals arrest at L2 due to absence of most or all postembryonic somatic cell divisions. Some germline proliferation resulting in slightly elongated gonad.
LP193 C. elegans cpIs56 II; unc-119(ed3) III. Show Description
cpIs56 [mex-5p::TagRFP-T::PLC(delta)-PH::tbb-2 3'UTR + unc-119 (+)] II. Reporter labels plasma membrane in early embryo. Transgene construct consisted of a germline promoter sequence (mex-5) driving the expression of a fluorescent protein fused to the N-terminus of the the pleckstrin homology domain from phospholipase C-(delta)1 (PH domain) and a 2x Flag epitope tag. Reference: Heppert JK, et al. Mol Biol Cell. 2016 Nov 7;27(22):3385-3394.
LP262 C. elegans cpEx25. Show Description
cpEx25 [mrck-1(delta CRIB)::YPet + myo-2p::mCherry]. Pick mCherry+ animals to maintain array. YPet-tagged MRCK-1 truncated upstream of the CRIB domain to inhibit binding to CDC-42. Generated in N2 background. Reference: Marston DJ, et al. Curr Biol. 2016 26:2079-2089.
LP306 C. elegans cpIs53 II; unc-119(ed3) III. Show Description
cpIs53 [mex-5p::GFP-C1::PLC(delta)-PH::tbb-2 3'UTR + unc-119 (+)] II. Reporter labels plasma membrane in early embryo. Transgene construct consisted of a germline promoter sequence (mex-5) driving the expression of a fluorescent protein fused to the N-terminus of the pleckstrin homology domain from phospholipase C-(delta)1 (PH domain) and a 2x Flag epitope tag. Reference: Heppert JK, et al. Mol Biol Cell. 2016 Nov 7;27(22):3385-3394.
LP307 C. elegans cpIs54 II; unc-119(ed3) III. Show Description
cpIs54 [mex-5p::mKate::PLC(delta)-PH(A735T)::tbb-2 3'UTR + unc-119 (+)] II. Reporter labels plasma membrane in early embryo. Transgene construct consisted of a germline promoter sequence (mex-5) driving the expression of a fluorescent protein fused to the N-terminus of the pleckstrin homology domain from phospholipase C-(delta)1 (PH domain) and a 2x Flag epitope tag. Reference: Heppert JK, et al. Mol Biol Cell. 2016 Nov 7;27(22):3385-3394.
LP308 C. elegans cpIs55 II; unc-119(ed3) III. Show Description
cpIs55 [mex-5p::mCherry-C1::PLC(delta)-PH::tbb-2 3'UTR + unc-119 (+)] II. Reporter labels plasma membrane in early embryo. Transgene construct consisted of a germline promoter sequence (mex-5) driving the expression of a fluorescent protein fused to the N-terminus of the pleckstrin homology domain from phospholipase C-(delta)1 (PH domain) and a 2x Flag epitope tag. Reference: Heppert JK, et al. Mol Biol Cell. 2016 Nov 7;27(22):3385-3394.
LP402 C. elegans cpIs64 II; unc-119(ed3) III. Show Description
cpIs64 [mex-5p::mYPet::PLC(delta)-PH::tbb-2 3'UTR + unc-119 (+)] II. Reporter labels plasma membrane in early embryo. Transgene construct consisted of a germline promoter sequence (mex-5) driving the expression of a fluorescent protein fused to the N-terminus of the pleckstrin homology domain from phospholipase C-(delta)1 (PH domain) and a 2x Flag epitope tag. Reference: Heppert JK, et al. Mol Biol Cell. 2016 Nov 7;27(22):3385-3394.