FF41 |
C. elegans |
unc-116(e2310) III. Show Description
Hypomorphic allele. Fully viable and fertile. Strongly uncoordinated larvae, tend to coil backward. Dpyish, mildly Unc adults. Isolated out of a mutator strain also containing uncharacterized e2281 and e2282.
|
|
KG4731 |
C. elegans |
unc-116(ce815[LoxP+sup-1(e995)+LoxP]) III. Show Description
Lox P sites in 3' UTR and 4th intron flank kinesin motor domain sequences; sup-1(e995) mini-gene inserted in second intron. Appears wild-type on plates and in quantitative locomotion assays. Can be used to conditionally delete gene sequences encoding the conventional kinesin motor domain in a tissue specific manner by driving expression of Cre recombinase in the tissue of interest. Reference: Stec N, et al. (Submitted). An Intron Compatible Marker for Long Distance CRISPR Mediated Gene Editing in Caenorhabditis elegans.
|
|
NJ546 |
C. elegans |
unc-116(rh24) III; cat-6(e1861) V. Show Description
Paralyzed Unc. Abnormal excretory canal. Abnormal amphid sheath cell.
|
|
VC4653 |
C. elegans |
unc-116(gk5722[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/+ III. Show Description
[NOTE: Please see RG5041 for balanced version of this strain.] Apparent homozygous lethal or sterile deletion as unbalanced heterozygote. Deletion of 2264 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Pick viable fertile GFP+ animals to maintain. Left flanking sequence: TCTTTGAAATGACGGATTTTTGGACCACAT. Right flanking sequence: CCCGGCTTCTCCTTACAATGCCTGCAATAA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
RG5041 |
C. elegans |
+/mT1 [umnIs52] II; unc-116(gk5722[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/ mT1 [dpy-10(e128)] III. Show Description
umnIs52 [myo-2p::mKate2 + NeoR, III: 8856215 (intergenic)] II. Pick viable fertile GFP+ and mKate2+ animals to maintain. Apparent homozygous lethal or sterile deletion as unbalanced heterozygote. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate2 (gk5722 homozygotes), sterile Dpy non-GFP mKate2+ mT1 homozygotes, and large numbers of arrested aneuploid embryos. Derived from parental strains VC4653 and CGC66. gk5722 is a 2264 bp deletion with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: TCTTTGAAATGACGGATTTTTGGACCACAT; Right flanking sequence: CCCGGCTTCTCCTTACAATGCCTGCAATAA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
UDN100080 |
C. elegans |
unc-116(udn42) III. Show Description
Control edit allele T90T. Wild-type looking. TspRI restriction site created by synonymous changes for ease of genotyping.
|
|
UDN100083 |
C. elegans |
unc-116(udn45)/qC1 [dpy-19(e1259) glp-1(q339)] nIs189 III. Show Description
nIs189 [myo-2::GFP] integrated in or near qC1. No recombination seen between nIs189 and qC1; fails to complement all markers on qC1. Pick slightly dumpy GFP+ to maintain. Heterozygotes are slightly dumpy GFP+ (pharynx), and segregate slightly dumpy GFP+ heterozygotes, Dpy Sterile GFP+ (qC1 homozygotes), non-GFP udn45 homozygotes (early larval arrest and Unc), and a few slow-growing wild-type looking or thin GFP+ heterozygotes. These thin GFP+ animals give rise to almost exclusively GFP+ progeny; a possible interaction between unb45 and qC1 is suspected. Variant edit allele T90I. TspRI restriction site created by synonymous changes for ease of genotyping.
|
|
UDN100169 |
C. elegans |
unc-116(gk5722udn86)/qC1 [dpy-19(e1259) glp-1(q339)] nIs189 III. Show Description
nIs189 [myo-2::GFP] integrated in or near qC1. No recombination seen between nIs189 and qC1; fails to complement all markers on qC1. Pick wild-type GFP+ to maintain. Heterozygotes are wild-type GFP+ (pharynx), and segregate wild-type GFP+ heterozygotes, Dpy Sterile GFP+ (qC1 homozygotes), and non-GFP gk5722udn86 homozygotes (larval arrest; few escapers). Derived from VC4653; selection cassette in VC4653 was removed, and then crossed with qC1 nIs189 [myo-2::GFP] balancer.
|
|
UDN100201 |
C. elegans |
jsSi1579 jsSi1606 II. Show Description
jsSi1606 [loxP::unc-116(+)::FRT3] II. Single copy unc-116(+) insertion at the standard Chr II ttTi5605 mosSCI site. jsSi1579 is an RMCE landing pad inserted at a sgRNA site 45 bp from the ttTi5605 insertion site. It contains an rpl-28p::GFP reporter flanked by FRT and FRT3 sites and a loxP site (for more details about landing pads, see Nonet, 2020.Genetics or visit https://sites.wustl.edu/nonetlab/rmce/).
|
|
XE2411 |
C. elegans |
unc-116(rh24sb79) III; oyIs14 V. Show Description
oyIs14 [sra-6p::GFP + lin-15(+)]. Disrupted mitochondrial trafficking. sb79 is an intragenic suppressor of the rh24 gain-of-function allele. Reference: Ding C, et al. Elife. 2022 Mar 14;11:e73557. PMID: 35285800.
|
|