More Fields
Strain Species Genotype
CF1135 C. elegans egl-20(n585) IV; muEx68. Show Description
muEx68 [(pJW33) myo-2p::egl-20::GFP + (7PD10.46) unc-22 (antisense)]. Use nicotine or levamisole to pick twitchers. Reference: Whangbo J & Kenyon C, (1999) Mol Cell 4(5):851-8.
CF1170 C. elegans egl-20(n585) IV; muEx79. Show Description
muEx79 [(pJW33) myo-2p::egl-20::GFP + (7PD10.46) unc-22 (antisense)]. Use nicotine or levamisole to pick twitchers. Reference: Whangbo J & Kenyon C, (1999) Mol Cell 4(5):851-8.
HP17 C. elegans sos-1(pd10) V. Show Description
sos-1 gain-of-function allele originally isolated as a suppressor of sem-5(n1619) lethality. pd10 causes a E99K substitution within the N-terminal histone fold domain of SOS-1. Single mutants appear wild-type.
PD1074 C. elegans C. elegans wild isolate. Show Description
A defined and recently cloned population of animals derived from the original “Bristol” variant of C. elegans originally obtained by Brenner from E. Dougherty with no known history of mutagenesis. Brenner’s original population, called N2, was used as the basis for the vast majority of laboratory strains in use currently. No early frozen stock of the unmutagenized N2 population currently exists, but later stocks were available from several laboratories. PD1074 is a clonal population founded by picking a single worm of one such stock, VC3510. VC3510 in turn derives from a subpopulation of N2 described in the literature as VC2010. PD1074 is intended to be used as a wild type reference strain with the closely matched genome assembly of Yoshimura, et al. (Genome Res. 2019 Jun;29(6):1009-1022) available on Wormbase as VC2010-1.0. (ENA study accession PRJEB28388; assembly accession GCA_900538205). We note that PD1074 is expected to be largely similar to most lab N2 strains, but that as a clonal isolate derived from N2, there will be some loci that will vary compared to any other particular N2 isolate. One such example is a partial deletion of the alh-2 locus in PD1074. Additional loci that were found to vary between the prior N2 reference genome (WormBase release WS264) and the VC2010-1.0 assembly are detailed in supplemental table 8 in Yoshimura, et al, (2019).
RG3040 C. elegans +/nT1 [umnIs49] IV; F58H1.6(ve540[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/nT1 V. Show Description
umnIs49 [myo-2p::mKate2 + NeoR, V: 1005689 (intergenic)] IV. Homozygous Ste with a few escapers. Deletion of 1527 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain PD1074. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, Sterile GFP+ non-mKate2 (ve540 homozygotes, some escapers will lay broods), Vul non-GFP mKate2+ (nT1 homozygotes) and dead eggs. Maintain by picking wild-type GFP+ mKate2+. Left flanking Sequence: aagtccgagataaataatctacatcctcat ; Right flanking sequence: TATCCAAGAAACACAGATTGGGATTGCAAA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3056 C.elegans B0464.6(ve556[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) III. Show Description
Homozygous viable. Deletion of 2168 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain PD1074. Left flanking Sequence: GTTTCACAAAATGAATAAATTGAGCGATAG ; Right flanking sequence: TGATGCCTGTGATGTGTTGAGTAATGAATA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3057 C. elegans mrpl-41(ve557[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/+ II. Show Description
Unbalanced heterozygote. Homozygous lethal, arrests at late larval stage with a few escapers that become sterile adults. Pick viable fertile GFP+ animals to maintain. Deletion of 1032 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain PD1074. Left flanking Sequence: ACTGGTGCTCGTAAGCACTCGTGGAGTCCG ; Right flanking sequence: TGTTCAAATCGAAAAGCGACGAGTTGCGTA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3058 C. elegans C01G6.5(ve558[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) II. Show Description
Homozygous viable, Egl. Deletion of 3209 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain PD1074. Left flanking Sequence: ttccacataagatcttaaaatacagaaata ; Right flanking sequence: ggtgggaaaaacagaagaaaagcatgtcgt. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3059 C. elegans C04F5.8(ve559[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) V. Show Description
Homozygous viable. Deletion of 2256 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain PD1074. Left flanking Sequence: CCGAGTCCCCGTGAGCTCTCGAATCCCGTA ; Right flanking sequence: atgggttactgtagcgcttgtatcgattta. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3060 C. elegans B0261.1(ve560[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/hT1 [umnIs58] I; +/hT1 [unc-42(e270)] V. Show Description
umnIs58 [myo-2p::mKate2 + NeoR, V: 1005689 (intergenic)] V. Homozygous Let. Deletion of 4055 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain PD1074. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate2 arrested larvae (ve560 homozygotes),  non-GFP mKate2+ arrested larvae (hT1 homozygotes), and dead eggs. Maintain by picking wild-type GFP+ and mKate2+. Left flanking Sequence: AATGCACAATTTGCATCTCCAAATCCGCCA ; Right flanking sequence: ccgttattttacgactgtcaaatctccatt. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3062 C. elegans C05C8.7(ve562[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/nT1 [umnIs49] IV; +/nT1 V. Show Description
umnIs49 [myo-2p::mKate2 + NeoR, V: 1005689 (intergenic)] IV. Homozygous Emb. Deletion of 3553 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain PD1074. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, Vul non-GFP mKate2+ (nT1 homozygotes) and dead eggs (ve562 homozygotes and aneuploids). Maintain by picking wild-type GFP+ mKate2+. Left flanking Sequence: attgaaaaaagtgttggtattaccccgtaa ; Right flanking sequence: TATGGTGTCTTCTGATCAATTTGGAAACTT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3063 C. elegans sucl-1(ve563[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) X. Show Description
Homozygous viable. Deletion of 1669 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain PD1074. Left flanking Sequence: tatttcatttaaatcaccttatttgtattt ; Right flanking sequence: TGGCCACCGCTTTCCTGGGAAAGATCTAAa. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3064 C. elegans skr-17(ve564[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) II. Show Description
Homozygous viable. Deletion of 718 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain PD1074. Left flanking Sequence: agggtgttttaaaatttgaatttgccgccg ; Right flanking sequence: ATGGGATGATTAAttttctgttactatctt. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3066 C. elegans snpc-1.1(ve566[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/mnC1 [dpy-10(e128) unc-52(e444) umnIs37] II. Show Description
umnIs37 [myo-2p::mKate2 + NeoR, II: 11755713 (intergenic)] II. Homozygous Lvl. Deletion of 2013 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain PD1074. Heterozygotes are wild-type GFP+ mKate2+ and segregate wild-type GFP+ mKate2+, GFP+ non-mKate2 dead larvae (ve566 homozygotes) and paralysed DpyUnc non-GFP mKate2+ (mnC1 homozygotes). Maintain by picking wild-type GFP+ mKate2+ animals. Left flanking Sequence: agattaataaaataacaaaagtcggagatg ; Right flanking sequence: gcgggaaccagcggtattcaacgcatttca. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3068 C. elegans C25A1.16(ve568[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/hT2 [umnIs73] I; +/hT2 [bli-4(e937) let-?(h661)] III. Show Description
umnIs73 [myo-2p::mKate2 + NeoR, III: 9421936 (intergenic)] I. Homozygous Lvl. Deletion of 477 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain PD1074. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate2 dead larvae (ve568 homozygotes), non-GFP mKate2+ arrested animals (arrest stage unknown)(hT2 homozygotes) and dead eggs (aneuploids). Pick wild-type GFP+ mKate2+ and check for correct segregation of progeny to maintain. [NOTE: Apparently the lethal mutation is closely linked but not within the balanced region of hT2. It can occasionally recombine away so that the strain will segregate Bli-4 hT2 homozygotes. (Mark Edgley)] Left flanking Sequence: TTTCACCCCCAATAAACCTATCAATTATCA ; Right flanking sequence: tcaggtttaaattagatttcttcgaatttg. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3084 C. elegans C25D7.1(ve584[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) V. Show Description
Homozygous viable. Deletion of 584 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain PD1074. Left flanking Sequence: tacaagtattctggaaaaaagccgaaccaa ; Right flanking sequence: tgcaaaaatatcttacCTCTGGATCAATTG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
XA8400 C. elegans qaIs8400. Show Description
qaIs8400 [let-858p::Ov-GST-3 + rol-6(su1006)]. Called AK1 in the reference article. The Ov-GST-3 gene was amplified from genomic DNA of O. volvulus with 1µM of the sequence specific primer 5'Klon and 3'Klon (5'Klon: 5'-GGCGTACGATGTCAAGATTTCCTCAACAAG-3'; 3'Klon: 5'-GGTCTAGATTTATTTAGGAATGATTGAATCGGTCG-3'; representing bases 4 - 25 and the complementary sequence of bases 821 - 841 of the published Ov-GST-3 cDNA (AF203814); bold underlines indicate restriction sites for Pfl23II (SplI) and XbaI, respectively; dotted underline indicates the start codon for translation; italics indicates the conserved sequence for the polyadenylation signal for transgenic transcript processing; the 8 5'-nucleotides of primer 3'Klon and the fourteen 5'-nucleotides of primer 5'Klon do not correspond to the template and introduce the sequences to the amplicon), 200 µM of each deoxynucleotide (Gibco BRL) and 2.5 units of Taq polymerase (Gibco BRL). After an initial denaturation of 3 minutes at 93°C, 35 cycles of annealing at 55°C for 1 minute, synthesis at 72°C for 2 minutes and a 1 minute denaturation at 93°C were performed, followed by a final extension at 72°C for 5 minutes. The genomic Ov-GST-3 fragment obtained by PCR (see above) was ligated into the pGEM-T Easy vector (Promega) by TA-cloning, cleaved with the restriction enzymes Pfl23II (SplI) and XbaI (restriction sites introduced by the primer) and inserted between the unique Pfl23II (SplI) and XbaI sites of the vector pPD103.05 (kindly provided by A. Fire). The sequence of the genomic Ov-GST-3 fragment in the resulting plasmid pAK1 was confirmed by automated dye terminator, dideoxy sequencing (ABI Prism 377TM Sequencer, PE Applied Biosystems) using the PCR primers (see above). The pAK1 DNA was injected in combination with the marker plasmid pRF4 [rol-6(su1006)] into the gonads of N2 C. elegans at a concentration of approximately 100 ng/µl for each plasmid. Transgenic worms were identified by the selectable Roller marker phenotype and the stable transmitting line AK1ex (AK1 extrachromosomal) was established. Integration of the extrachromosomal arrays was achieved by irradiation of AK1ex worms with 3600 rad (1 rad = 0.01 Gy) of x-rays (x-ray chamber: RUM 9421-070-77002, Philips, Netherlands; dosimeter: PTW-SN4, PTW, Germany). The progeny of these worms was then screened for 100% transmittance of the Roller phenotype to obtain the C. elegans line AK1int (AK1 integrated) with the chromosomally integrated transgenes.