Strain Information
Name | CZ25708 View On Wormbase |
---|---|
Species | C. elegans |
Genotype | prg-1(ju1574) I. |
Description | Temperature sensitive sterility: maintain at 15-20C. prg-1(ju1574) mutant animals become sterile at the fifth generation grown at 25C. prg-1(ju1574) contains two mutations in the PIWI domain active site (RNaseH/slicer) [D583A, Y585A]. Mutation of the first conserved aspartate of the catalytic triad (D-D-H motif) to alanine (D583A) created an A-D-H motif which abolishes slicer activity in Argonaute proteins. WT: [GTCGGCTACGATCTGTACCACGACTCGACATTGAAAGGAAAAACT --> VGYDLYHDSTLKGKT] ju1574: [GTCGGCTACGcgCTGgctCAtGAtTCGACATTGAAAGGAAAAACT --> CGYALAHDSTLKGKT] Forward genotyping primer: GTAATGCTCGCTGACGACAA Reverse genotyping primer: TTGACGAACTGTGGAACCAA Reference: Kim KW, et al. Neuron. 2018 Feb 7;97(3):511-519.e6. doi: 10.1016/j.neuron.2018.01.014. |
Mutagen | Crispr/Cas9 |
Outcrossed | x1 |
Made by | Kyung Won Kim |
Laboratory | CZ |
Reference | Kim KW, Tang NH, Andrusiak MG, Wu Z, Chisholm AD, Jin Y. A Neuronal piRNA Pathway Inhibits Axon Regeneration in C. elegans. Neuron. 2018 Feb 7;97(3):511-519.e6. doi: 10.1016/j.neuron.2018.01.014. Epub 2018 Jan 27. |
Sign in
or
register an account if you want to order this strain.