Search Strains

sos-1(pd9) is a gain-of-function allele causing a C662Y substitution within the Ras exchange motif of SOS-1. Originally isolated as a suppressor of sem-5(n1619) lethality. Single mutants appear wild-type. Reference: Wooller A & Hopper N. (2014) European Worm Meeting. (Anyone using this allele may cite Neil Hopper as a personal communication based on this meeting abstract.)

Heterozygotes are WT and segregate WT, DpyUncs and Unc Steriles that are slightly Long. sb56 is a recessive zygotic suppressor of let-502(ca201) early larval lethality. Likely null of mel-11.

Egl, Pvul, Psa (Phasmid Socket Absent) and some embryonic lethality. The T cell division can be symmetric as in lin-17 mutants. Less severe at 15C. swsn-4 encodes a homolog of yeast SW12, a component of the SWI/SNF complex.

Bacteria. Genotype: F-, mcrA, mcrB, IN(rrnD-rrnE)1, rnc14::Tn10(DE3 lysogen: lacUV5 promoter -T7 polymerase) (IPTG-inducible T7 polymerase) (RNAse III minus). This strain grows on LB or 2XYT plates. This strain is tetracycline resistant. Researchers using this strain should test for expression by transforming in one of the plasmids from the Fire Vector Kit (1999) (pLT76, e.g.) using standard CaCl2 transformation techniques. Biosafety Level: BSL-1.

Heterozygotes are WT and segregate WT, Sterile Dpys and Uncs. Unc worms produce only dead embyros due to strict maternal effect pod-1(ye11) mutation. Embryos from pod-1 homozygous hermaphrodites are osmotically sensitive and exhibit polarity defects.

Temperature-sensitive embryonic lethal, maintain at 15C. Shift L4 hermaphrodites to 25C overnight for mutant embryos. Mutant embryos are sensitive to osmolarity and pressure. Previously called pod-4(or344).

Temperature-sensitive embryonic lethal, maintain at 15C. Shift L4 hermaphrodites to 25C overnight for mutant embryos. Mutant embryos are sensitive to osmolarity and pressure. Previously called pod-5(ye121).

Temperature-sensitive embryonic lethal, maintain at 15C. Shift L4 hermaphrodites to 24C overnight for mutant embryos. Mutant embryos are sensitive to osmolarity and pressure. Previously called pod-3 and mat-2.

Temperature-sensitive embryonic lethal, maintain at 15C. Shift L4 hermaphrodites to 25C overnight for mutant embryos. Mutant embryos are sensitive to osmolarity and pressure. Previously called pod-3 and mat-2..

Temperature-sensitive embryonic lethal, maintain at 15C. Shift L4 hermaphrodites to 25C overnight for mutant embryos. Mutant embryos are sensitive to osmolarity and pressure. Previously called pod-3 and mat-2.

Temperature-sensitive embryonic lethal, maintain at 15C. Shift L4 hermaphrodites to 25C overnight for mutant embryos. Mutant embryos are sensitive to osmolarity and pressure. Previously called pod-6(ye143).

quEx102[F25B3.3::SAX-3 + odr-1::RFP]. F25B3.3::SAX-3 partially rescues the lethality and notch phenotype of sax-3(ky123). Maintain by picking RFP+.

quEx100 [ajm-1::sax-3 + odr-1::RFP]. ajm-1::sax-3 partially rescues the lethality of sax-3(ky123). Maintain by picking RFP+.

quEx99 [sax-3(minigene) + odr-1::RFP]. Rescues the lethality of ky123. Pick RFP+ to maintain.

Healthy and fertile but exhibit a lowly penetrant lethality, and a small but significant proportion of the mutants arrest as early larvae. Reference: Pujol N, et al. Curr Biol. 2001 Jun 5;11(11):809-21.

Maintain at 15C. At 25C, nr2013 homozygotes are not viable. At 15C, less than 10% of nr2013 homozygotes develop into adults that are marginally fertile, while the majority of worms arrest at different developmental stages and exhibit dramatic defects in morphogenesis. Reference: Pujol N, et al. Curr Biol. 2001 Jun 5;11(11):809-21.

frSi17 [mtl- 2p::rde-1 3'UTR] II. frIs7 [nlp-29p::GFP + col-12p::DsRed] IV. frSi17 inserted into ttTi5605 site using CRISPR/Cas9 engineering. RDE-1 activity is rescued in the intestine, making animals RNAi-deficient except for intestinal tissues. The frSi17 insertion can be detected using a primer within the mtl-2 promoter (jep1061: aacaaacgtgggatgtaacc) in combination with downstream primer in rde-1 (jep2817 tcatactcgtagtattcccg), producing a 786 bp product if insertion is present. rde-1(ne300) can be genotyped by sequencing the PCR product from jep2299: gaacaacgacaatcgagcacca and jep3108: ATcttgtgaccgaactgtcc. (jep3108 is not present in the frSi17 transgene) Reference: Watts JS, et al. G3 (Bethesda) 2020 Nov 5;10(11):4167-4176. PMID: 32943454

frSi21 [col-62p::rde-1 3'UTR] II. frIs7 [nlp-29p::GFP + col-12p::DsRed] IV. frSi21 inserted into ttTi5605 site using CRISPR/Cas9 engineering. RDE-1 activity is rescued in adult epidermal tissues, making animals RNAi-deficient except for hypodermal (skin) tissues from the young adult stage. The frSi21 insertion can be detected using a primer within the col-62 promoter (jep2245: caaaaaggcgggatgagcag) in combination with downstream primer in rde-1 (jep2817 tcatactcgtagtattcccg), producing a 965 bp product if insertion is present. rde-1(ne300) can be genotyped by sequencing the PCR product from jep2299: gaacaacgacaatcgagcacca and jep3108: ATcttgtgaccgaactgtcc (jep3108 is not present in the frSi21 transgene). Reference: Watts JS, et al. G3 (Bethesda) 2020 Nov 5;10(11):4167-4176. PMID: 32943454

RNAi-capable OP50 strain. Tetracycline & Chloramphenicol resistant. Uracil auxotroph. E. coli B. Biosafety Level: BSL-1. Standard OP50 (CGC) was rendered RNAi competent through two modifications by phage transduction. The OP50 RNase III (rnc) allele was replaced with the deletion allele (rnc14::?Tn10) found in HT115(DE3), and a genomically encoded IPTG-inducible T7 RNA polymerase (lacz?A::T7pol camFRT) was introduced. Reference: Neve IAA, et al. G3 (Bethesda). 2019 Nov 11. pii: g3.400741.2019.

kpIs100 [pie-1p::Ub(G76V)::GFP::H2B::drp-1 3' UTR + unc-119(+)]. [NOTE: (4/4/2025): Strain segregates Rol, and non-Rol, possibly due to a background dpy-10 mutation; both express GFP as expected. It was recommended that non-Rollers be picked when maintaining the strain.] Expresses Ubiquitin::GFP fusion protein in the germ line. The last amino acid of ubiquitin is mutated to valine (G76V), which prevents the cleavage of ubiquitin from GFP by the deubiqutinating enzymes and renders the GFP constitutively targeted for degradation by the proteasome. The strain can be used to assay proteasome activity in the germ line. Reference: Kumar GA & Subramaniam K. Development. 2018 Mar 29;145(7):dev163949. PMID: 29540500

ufIs104 [nlp-12(+) + lgc-11p::GFP]. ufIs104 contains a 1.76 kb PCR product containing the nlp-12 genomic locus (?354 bp to +1407 bp relative to the transcriptional start). Over-expression of nlp-12 results in increased body bend amplitude. This strain has a high rate of sterility but can be successfully maintained as a homozygote. Reference: Bhattacharya R, et al. PLoS Genet. 2014 Aug 28;10(8):e1004584. doi: 10.1371/journal.pgen.1004584. PMID: 25167143.

egl-27(we3) animals have variable body morphology defects with cold sensitive embryonic/L1 lethality (5% die at 22C, 90% at 15C). Maternal effect vab-7(ed6) enhancer; semi-lethal with vab-7(ed6).

Hesitation in crossing an aversive ion. Defective in behavioral plasticity after conditioned with NaCl and starvation or with temperature and starvation.

jcpEx3 [ccz-1p::ccz-1(genomic)::YFP::let-858 3'UTR + unc-119(+) + pha-1(+)]. Array rescues lethality. Individuals that lost the array produce only arrested embryos with spindle orientation defects, accumulate vesicles, and problems engulfing apoptotic corpses. Reference: Nieto C, et al. J Cell Sci. 2010 Jun 15;123(Pt 12):2001-7.

jcpEx6 [nxf-1p::nxf-1::3xFLAG::eGFP::nxf-1UTR]. jcpEx6 transgene rescues nxf-1(t2160) embryonic lethality at 25C. Temperature-sensitive; maintain at 25C to retain the array. nxf-1(t2160) mutants are 100% embryonic lethal at 25C. Reference: Zheleva A, et al. PLoS Genet. 2019 Sep 16;15(9):e1008338.

Superfically wild-type. hsr-9(xoe17) was generated by incorporating a stop-in cassette early in the coding region using the co-CRISPR method (Paix et al. 2015). The hsr-9 repair template (gattttgcctcttaaataaaatttcagCAAAAAACCGAGGGGAGACTTGCAATAGGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAGCTAGCTCTCGGATCATCTTGCAAACATGCTTATTGCTGgtaggtattgcaacc) and guide RNA (AGGGGAGACTTGCAATATCT) were injected into N2 and the resulting progeny were analyzed by PCR using TGAAATTAAGGTGGTCACTCGAAG and GTTGTTGTGGGGAGGCTGAA. Reference: Hariri S, et al. (2023). 53bp1 mutation enhances brca1 and bard1 embryonic lethality in C. elegans. microPublication Biology. 10.17912/micropub.biology.000934. PMID: 37581122.

Emb. Reference: Hariri S, et al. (2023). 53bp1 mutation enhances brca1 and bard1 embryonic lethality in C. elegans. microPublication Biology. 10.17912/micropub.biology.000934. PMID: 37581122.

Superfically wild-type. polq-1(xoe51) was generated by incorporating a stop-in cassette early in the coding region using the co-CRISPR method (Paix et al. 2015). The polq-1 repair template (AGAGAATTCTCTGAAGATCCATTAATATTGCTTACCGAAGGGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAGCTAGCAGAGTTTTCGCCGCAATTCTCAGACTTTGGTAATGATTTC) and guide RNA (ATTGCGGCGAAAACTCTCTT) were injected into N2 and the resulting progeny were analyzed by PCR using ATAGGCAAATGGCTGGACGG and TCAAAGCAGTCTTCTCGGCA. Reference: Hariri S, et al. (2023). 53bp1 mutation enhances brca1 and bard1 embryonic lethality in C. elegans. microPublication Biology. 10.17912/micropub.biology.000934. PMID: 37581122.

Emb. Reference: Hariri S, et al. (2023). 53bp1 mutation enhances brca1 and bard1 embryonic lethality in C. elegans. microPublication Biology. 10.17912/micropub.biology.000934. PMID: 37581122.

Emb. Reference: Hariri S, et al. (2023). 53bp1 mutation enhances brca1 and bard1 embryonic lethality in C. elegans. microPublication Biology. 10.17912/micropub.biology.000934. PMID: 37581122.

itIs153 [pie-1p::par-2::GFP + rol-6(su1006) + N2 genomic DNA]. ojIs1 [pie-1p::GFP::tbb-2 + unc-119(+)]. Maintain at 25C. Constructed by crossing heterozygous ojIs1 males into KK866 (itIs153) hermaphrodites and selecting for double homozygosity of the arrays. itIs153 is an integrated derivitive of axEx1094.

pptr-1(tm3103) is a temperature-sensitive allele. Maintain at 15C. Fully penetrant P granule partitioning defect at 20-24C. Low penetrance of sterilty observed at 24-26C. Reference: Gallo CM, et al. Science. 2010 Dec 17;330(6011):1685-9.

P granule defect. High sterility. Reference: Wang JT, et al. eLife 2014;3:e04591.

P granule defect. Some sterility. Reference: Wang JT, et al. eLife 2014;3:e04591.

Embryonic P granules not segregated, 30% maternal effect sterility on average, RNAi insensitivity. meg-3(ax3055) and meg-4(ax3052) are precise deletions of the entire coding sequence made by CRISPR/Cas9, designed to be cut again to make insertions at the endogenous locus. References: Smith, J. et al. Elife. 2016 Dec 3;5:e21337. doi: 10.7554/eLife.21337. PMID: 27914198 Ouyang JPT, et al. Dev Cell. 2019 Sep 23;50(6):716-728.e6. PMID: 31402283

Description: 20% maternal effect sterility on average, RNAi insensitivity, MEG-3 does not form cytoplasmic gradient. meg-3(ax4503) is an in-frame deletion in the endogenous meg-3 locus removing amino acids (1-544); MEG-3 does not form a cytoplasmic gradient but does still form granules in early embryos and co-localizes with PGL-3. References: Smith, J. et al. Elife. 2016 Dec 3;5:e21337. doi: 10.7554/eLife.21337. PMID: 27914198 Schmidt H, bioRxiv 2020.10.15.340570 (2020) doi:10.1101/2020.10.15.340570.

20% Maternal effect sterility on average, embryonic P granule defect, RNAi insensitivity. Engineered mutations in the endogenous meg-3 locus disrupt the binding and localization of PGL proteins to P granules in the early embryo while MEG-3 itself is still forms an asymmetric cytoplasmic gradient and granules. References: Smith, J. et al. Elife. 2016 Dec 3;5:e21337. doi: 10.7554/eLife.21337. PMID: 27914198 Schmidt H, bioRxiv 2020.10.15.340570 (2020) doi:10.1101/2020.10.15.340570.

ujIs113 [pie-1p::mCherry::H2B::pie-1 3'UTR + nhr-2p::his-24::mCherry::let-858 3'UTR + unc-119(+)] II. ujEx173 [ceh-36::TY1::eGFP::3xFLAG + unc-119(+)]. ujEx173 rescues unc-36, suppressing synthetic lethality in animals carrying the array. Reference: Walton T, et al. PLoS Genet. 2015 Mar 4;11(3):e1005003.

Temperature sensitive. At restrictive temperature (26C), efl-1 produces dead eggs with a Mex phenotype. Two ts periods: 1) prior to L4 results in sterility, 2) after L4 results in a maternal-effect embryonic lethal phenotype.

Heterozygotes are WT and GFP+. q568(ts) homozygotes are sterile and can exhibit a white-patch phenotype. The severity of the white-patch increases with increasing temperature. nT1[qIs51] is probably homozygous lethal. qIs51 is an insertion of ccEx9747 with markers: myo-2::GFP expressed in the pharynx throughout development, pes-10::GFP expressed in the embryo, and a gut promoter F22B7.9::GFP expressed in the intestine. Crosses with this strain generate very few glowing hermaphrodite cross progeny and many glowing male cross progeny. Do not distribute this strain; other labs should request it directly from the CGC.

qIs89 [gon-14::gon-14::VENUS + S. cerevisiae DNA]. gon-14::VENUS is broadly expressed in cell nuclei starting at the 50-100 cell stage of embryogenesis and throughout larval development. Partially concentrated in nuclear speckles. qIs89 rescues the 25C Gon and Ste defects of q686. Low penetrance of sterility and lethality in the strain. Do not distribute this strain; other labs should request it from the CGC.

qSi156 [glp-1::Halotag + Cbr-unc-119(+)] IV. Mos insertion of Halo tagged GLP-1 in glp-1(null) background. qSi156 mostly rescues glp-1(q46) sterility; partially penetrant embryonic lethality, early larval lethality and dumpiness. Reference: Sorensen EB, et al. A toolkit of tagged glp-1 alleles reveals strong glp-1 expression in the germline, embryo, and spermatheca. microPublication Biology, 2020(06). http://doi.org/10.17912/micropub.biology.000271

Heterozygotes are wild-type and segregate wild-type heterozygotes, glp-1(q35) homozygotes (Muv steriles), eT1 homozygotes (Unc-36), and males. glp-1(q35) has a semi-dominant multi-vulva phenotype as well as the loss-of-function Glp phenotype (sterility and embryonic lethality). The q35 mutation is a nonsense mutation that eliminates 122 C-terminal amino acids including a PEST sequence. The C terminus was thought to contain a negative regulatory domain that inactivates glp-1 in the VPCs; the inappropriate glp-1(q35) activity can substitute for lin-12 vulval fate determination. References: Austin J & Kimble J. Cell. 1987 Nov 20;51(4):589-99. Mango S, et al. Nature. 1991 Aug 29;352(6338):811-5.

q873[fog-3(1-262)::GGS::3xFLAG::fog-3(263 Phe)] I. qSi375 [mex-5p::eGFP::linker::his-58::3xboxb::tbb-2 3’UTR] II. The tethering assay allows this strain to be used for determining FOG-3 levels in different genetic backgrounds. Similar fertility to N2 wild type. Reference: Aoki S, et al. Cell Rep. 2018 Jun.26; 23(13):3769-3775

Pick GFP+ to maintain. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP q869 q1054 homozygotes (sterility/reduced fertility). Homozygous hT2[bli-4 let-? qIs48] inviable. Maintain by picking GFP+ heterozygotes and checking for correct segregation of progeny to maintain a balanced stock. Reference: Lynch TR, et al. Development. 2022 Apr 1;149(7):dev200332. PMID: 35394007.

Pick GFP+ to maintain. CRIPSR-engineered modification of gld-1 FBEa and FBEa* in gld-1 3'UTR.  Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP q1243 homozygotes (sterility/reduced fertility). Homozygous hT2[bli-4 let-? qIs48] inviable. Maintain by picking GFP+ heterozygotes and checking for correct segregation of progeny to maintain a balanced stock. Increase in distal GLD-1 protein levels and decrease in proximal GLD-1 protein levels. Qiu et al., in preparation.

Pick GFP+ to maintain. C-teminal V5 epitope tag inserted into endogenous sygl-1 locus that has a CRISPR-engineered mutation of predicted Notch-dependent cis-regulatory elementa LBS BCD (Yoo et al., 2004). Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP q869 q1167 homozygotes (sterility/reduced fertility). Homozygous hT2[bli-4 let-? qIs48] inviable. Maintain by picking GFP+ heterozygotes and checking for correct segregation of progeny to maintain a balanced stock. Reference: Lynch TR, et al. Development. 2022 Apr 1;149(7):dev200332. PMID: 35394007.

Phenotypically normal except that it does not show ges-1 activity. Mutations (ca6ca7) are presumably misense or nonsense but have not been characterized genetically.

Partial maternal effect lethal. Lack of PHO-1 acid phosphatase activity on isoelectric focusing gel.

Suppresses nep-2 olfactory plasticity defect. Reference: Science. 2010 Sep 24;329(5999):1647-50.