More Fields
Strain Species Genotype
IG274 C. elegans frIs7. Show Description
frIs7 [nlp-29p::GFP + col-12p::DsRed] IV. The nlp-29p::GFP reporter is induced in the epidermis upon infection with Drechmeria coniospora, wounding and osmotic stress. Reference: Pujol N, et al. Curr Biol. 2008 Apr 8;18(7):481-9.
IG1107 C. elegans sta-2(fr67) V; frIs7 IV. Show Description
frIs7 [nlp-29p::GFP + col-12p::DsRed] IV. Blocks inducible expression of antimicrobial peptide nlp-29 after D. coniospara infection or treatment with PMA. Maintain under normal conditions. Reference: Labed Sa, et al. PLoS One. 2012 7(3):e33887.
IG1110 C. elegans snf-12(fr70) X; frIs7 IV. Show Description
frIs7 [nlp-29p::GFP + col-12p::DsRed] IV. Blocks inducible expression of antimicrobial peptide nlp-29 after D. coniospara infection or treatment with PMA. Maintain under normal conditions. Reference: Labed Sa, et al. PLoS One. 2012 7(3):e33887.
IG1114 C. elegans snf-12(fr74) X; frIs7 IV. Show Description
frIs7 [nlp-29p::GFP + col-12p::DsRed] IV. Blocks inducible expression of antimicrobial peptide nlp-29 after D. coniospara infection or treatment with PMA. Maintain under normal conditions. Reference: Labed Sa, et al. PLoS One. 2012 7(3):e33887.
IG1352 C. elegans nipi-4(fr71) V; frIs7 IV. Show Description
frIs7 [nlp-29p::GFP + col-12p::DsRed] IV. Blocks inducible expression of antimicrobial peptide nlp-29 after D. coniospara infection or treatment with PMA. Maintain under normal conditions. Reference: Labed Sa, et al. PLoS One. 2012 7(3):e33887.
IG339 C. elegans tpa-1(fr1) frIs7 IV. Show Description
frIs7 [nlp-29p::GFP + col-12p::DsRed] IV. Displays tpa-1 phenotypes (e.g. resistance to PMA). Isolated in a genetic screen for mutants failing to show an induction of nlp-29p::GFP reporter gene expression upon infection with the fungus Drechmeria coniospora (the Nipi phenotype). References: Pujol N, et al. Curr Biol. 2008 Apr 8;18(7):481-9. Ziegler K, et al. Cell Host Microbe. 2009 Apr 23;5(4):341-52.
IG341 C. elegans tpa-1(fr3) frIs7 IV. Show Description
frIs7 [nlp-29p::GFP + col-12p::DsRed] IV. Displays tpa-1 phenotypes (e.g. resistance to PMA). Isolated in a genetic screen for mutants failing to show an induction of nlp-29p::GFP reporter gene expression upon infection with the fungus Drechmeria coniospora (the Nipi phenotype). References: Pujol N, et al. Curr Biol. 2008 Apr 8;18(7):481-9. Ziegler K, et al. Cell Host Microbe. 2009 Apr 23;5(4):341-52.
IG342 C. elegans frIs7 IV; nipi-3(fr4) X. Show Description
frIs7 [nlp-29p::GFP + col-12p::DsRed] IV. Slo, Sma, and Dpy at 25C. Reference: Pujol N, et al. Curr Biol. 2008 Apr 8;18(7):481-9.
IG348 C. elegans fasn-1(fr8) I; frIs7 IV. Show Description
frIs7 [nlp-29p::GFP + col-12p::DsRed] IV. Constitutive expression of antimicrobial peptide nlp-29. Maintain under normal conditions. Reference: Lee KZ, et al. Virulence. 2010 May-Jun;1(3):113-22.
IG692 C. elegans tir-1(tm3036) III; frIs7. Show Description
frIs7 [nlp-29p::GFP + col-12p::DsRed] IV. Reference: Pujol N, et al. PLoS Pathog. 2008 Jul 18;4(7):e1000105.
CB7272 C. elegans ccIs4251 I; mIs12 II; dpy-17(e164) III; frIs7 IV; uIs69 V. Show Description
ccIs4251 [(pSAK2) myo-3p::GFP::LacZ::NLS + (pSAK4) myo-3p::mitochondrial GFP + dpy-20(+)] I. mIs12 [myo-2p::GFP + pes-10p::GFP + F22B7.9p::GFP] II. frIs7 [nlp-29p::GFP + col-12p::DsRed] IV. uIs69 [pCFJ90(myo-2p::mCherry) + unc-119p::sid-1] V. Mapping strain. This strain is homozygous for integrated fluorescence markers on LG I, II, IV and V, all of which are easily and independently scored using a fluorescent dissecting microscope, plus an easily scored visible marker (dpy-17) for LGIII. The good markers on all five autosomes facilitate linkage assignment of unmapped mutations, and enable rapid replacement of chromosomes when outcrossing heavily mutagenized strains such as those from the Million Mutation Project.
IG1839 C. elegans frSi17 II; frIs7 IV; rde-1(ne300) V. Show Description
frSi17 [mtl- 2p::rde-1 3'UTR] II. frIs7 [nlp-29p::GFP + col-12p::DsRed] IV. frSi17 inserted into ttTi5605 site using CRISPR/Cas9 engineering. RDE-1 activity is rescued in the intestine, making animals RNAi-deficient except for intestinal tissues. Reference: https://www.g3journal.org/content/early/2020/09/17/g3.120.401749
IG1846 C. elegans frSi21 II; frIs7 IV; rde-1(ne300) V. Show Description
frSi21 [col-62p::rde-1 3'UTR] II. frIs7 [nlp-29p::GFP + col-12p::DsRed] IV. frSi21 inserted into ttTi5605 site using CRISPR/Cas9 engineering. RDE-1 activity is rescued in adult epidermal tissues, making animals RNAi-deficient except for hypodermal (skin) tissues from the young adult stage. The frSi21 insertion can be detected using a primer within the inserted vector but outside the genomic rde-1 sequence included in the transgene (jep3108: ATcttgtgaccgaactgtcc) in combination with downstream primer (jep2445: caaaaaggcgggatgagcag), producing a 965 bp product if insertion is present. rde-1(ne300) can be genotyped by sequencing the PCR product from jep2299: gaacaacgacaatcgagcacca and jep3108: ATcttgtgaccgaactgtcc. Reference: https://www.g3journal.org/content/early/2020/09/17/g3.120.401749