Strain Information
| Name | IG1839 View On Wormbase |
|---|---|
| Species | C. elegans |
| Genotype | frSi17 II; frIs7 IV; rde-1(ne300) V. |
| Description | frSi17 [mtl- 2p::rde-1 3'UTR] II. frIs7 [nlp-29p::GFP + col-12p::DsRed] IV. frSi17 inserted into ttTi5605 site using CRISPR/Cas9 engineering. RDE-1 activity is rescued in the intestine, making animals RNAi-deficient except for intestinal tissues. The frSi17 insertion can be detected using a primer within the mtl-2 promoter (jep1061: aacaaacgtgggatgtaacc) in combination with downstream primer in rde-1 (jep2817 tcatactcgtagtattcccg), producing a 786 bp product if insertion is present. rde-1(ne300) can be genotyped by sequencing the PCR product from jep2299: gaacaacgacaatcgagcacca and jep3108: ATcttgtgaccgaactgtcc. (jep3108 is not present in the frSi17 transgene) Reference: Watts JS, et al. G3 (Bethesda) 2020 Nov 5;10(11):4167-4176. PMID: 32943454 |
| Mutagen | |
| Outcrossed | x0 |
| Made by | Nathalie Pujol |
| Laboratory | BX |
| Reference | This strain will be published in the November 2020 issue of G3. https://www.g3journal.org/content/early/2020/09/17/g3.120.401749 |
Sign in
or
register an account if you want to order this strain.