Strain Information
| Name | IG1846 View On Wormbase |
|---|---|
| Species | C. elegans |
| Genotype | frSi21 II; frIs7 IV; rde-1(ne300) V. |
| Description | frSi21 [col-62p::rde-1 3'UTR] II. frIs7 [nlp-29p::GFP + col-12p::DsRed] IV. frSi21 inserted into ttTi5605 site using CRISPR/Cas9 engineering. RDE-1 activity is rescued in adult epidermal tissues, making animals RNAi-deficient except for hypodermal (skin) tissues from the young adult stage. The frSi21 insertion can be detected using a primer within the col-62 promoter (jep2245: caaaaaggcgggatgagcag) in combination with downstream primer in rde-1 (jep2817 tcatactcgtagtattcccg), producing a 965 bp product if insertion is present. rde-1(ne300) can be genotyped by sequencing the PCR product from jep2299: gaacaacgacaatcgagcacca and jep3108: ATcttgtgaccgaactgtcc (jep3108 is not present in the frSi21 transgene). Reference: Watts JS, et al. G3 (Bethesda) 2020 Nov 5;10(11):4167-4176. PMID: 32943454 |
| Mutagen | Crispr/Cas9 |
| Outcrossed | x0 |
| Made by | Nathalie Pujol |
| Laboratory | BX |
| Reference | https://www.g3journal.org/content/early/2020/09/17/g3.120.401749 This paper will be published in the November edition of G3. |
Sign in
or
register an account if you want to order this strain.