Strain Information
| Name | JEL1134 View On Wormbase |
|---|---|
| Species | C. elegans |
| Genotype | polq-1(xoe51) III. |
| Description | Superfically wild-type. polq-1(xoe51) was generated by incorporating a stop-in cassette early in the coding region using the co-CRISPR method (Paix et al. 2015). The polq-1 repair template(AGAGAATTCTCTGAAGATCCATTAATATTGCTTACCGAAGGGGAAGTTTGTCCAGAGCA GAGGTGACTAAGTGATAAGCTAGCAGAGTTTTCGCCGCAATTCTCAGACTTTGGTAATGA TTTC) and guide RNA (ATTGCGGCGAAAACTCTCTT) were injected into N2 and the resulting progeny were analyzed by PCR using ATAGGCAAATGGCTGGACGG and TCAAAGCAGTCTTCTCGGCA. Reference: Hariri S, et al. (2023). 53bp1 mutation enhances brca1 and bard1 embryonic lethality in C. elegans. microPublication Biology. 10.17912/micropub.biology.000934. PMID: 37581122. |
| Mutagen | Crispr/Cas9 |
| Outcrossed | x3 |
| Made by | Sara Hariri |
| Laboratory | JEL |
| Reference | Hariri, S; Li, Q; Engebrecht, J (2023). 53bp1 mutation enhances brca1 and bard1 embryonic lethality in C. elegans. microPublication Biology. 10.17912/micropub.biology.000934. PMC ID: PMC10423319. PubMed ID: 37581122. |
Sign in
or
register an account if you want to order this strain.