Search Strains

More Fields
Strain Species Genotype Add
YL195 C. elegans pzf-1(vr3) V. Show Description
Superficially wild type.
YL206 C. elegans unc-119(ed3) III; vrEx6. Show Description
vrEx6 [nst-1p::nst-1::GFP::nst-1 3' UTR + unc-119(+)]. Stable array; high transmission rate and low percentage of mosaicism. Maintain by picking wild-type. Reference: Kudron et al. (2008) PLos Genet 4(8):e1000181.
YL651 C. elegans let-607(tm1423) I; unc-119(ed3) III; vrIs121. Show Description
vrIs121 [let-607(fosmid)::GFP + unc-119(+)]. let-607 locus in fosmid tagged at the carboxy-terminus with GFP. Derived by crossing the LET-607::GFP transgenic strain (YL529) to let-607(tm1423) mutants. vrIs121 transgene rescues the lethal mutant phenotype of let-607(tm1423) homozygous mutants. Reference: Weicksel SE, et al. Development. 2016 Oct 1;143(19):3540-3548.
YY13 C. elegans rrf-3(mg373) II; oxls12. Show Description
oxls12 [unc-47p::GFP + lin-15(+)]. Enhanced RNAi. Sterile at 25 degrees. [NOTE: the genotype of YY13 as previously annotated only as rrf-3(mg373)] References: Pavelec DM, et al. Genetics. 2009 Dec;183(4):1283-95. PMID: 19797044. McIntire SL, et al. Nature. 1997 Oct 23;389(6653):870-6. PMID: 9349821.
YY470 C. elegans dcr-1(mg375) III. Show Description
Enhanced RNAi response. Sterile at 25 C. Outcrossed from YY11; wild-type for mut-16. Superficially wild-type.
ZB1030 C. elegans crt-1(bz31) V. Show Description
Point mutation C133Y. No easily detected phenotype, selected for suppression of mec-4(d)-induced degeneration caused by ectopic expression of mec-4(d)-induced neurodegeneration. Bent-head.
ZB1031 C. elegans crt-1(bz50) V. Show Description
Point mutation in G102E. No easily detected phenotype, selected for suppression of mec-4(d)-induced degeneration caused by ectopic expression of mec-4(u231) in the ventral nerve cord. Bent-head.
ZD1866 C. elegans eif-2a(qd338) I. Show Description
Y37E3.10. qd338 disrupts Ser49 phosphorylation site; suppresses daf-28(sa191) constitutive dauer entry phenotype. Reference: Kulalert W, et al. Genetics 2017. In press.
ZD2005 C. elegans eif-2Ba(qd335) III. Show Description
ZK1098.4. qd335 suppresses daf-28(sa191) constitutive dauer entry phenotype. Reference: Kulalert W, et al. Genetics 2017. In press.
ZD500 C. elegans hecw-1(ok1347) III. Show Description
Pathogen avoidance phenotype. Defective nose touch response.
ZG444 C. elegans iaIs7 IV; egl-9(gk277) V. Show Description
iaIs7 contains [nhr-57p::GFP + unc-119(+)]. nhr-57p::GFP is expressed at low levels. Superficially wild-type. Published in Shao, Zhang, and Powell-Coffman Genetics (2009).
ZM10538 C. elegans hpIs774; hpEx4081. Show Description
hpIs774 [twk-40p(short)::GCaMP6s::mNeptune]. hpEx4081 [rig-3p::LoxP::eBFP::Stop::LoxP::gtACR2::wCherry + twk-40p(short)::Cre + myo-2p::RFP]. Pick RFP+ (pharynx) to maintain. Transgenic animals are GFP and RFP positive in multiple neurons in the head, but strong RFP signals in AVA neurite. Superficially wild type. Activation of gtACR2 decreases AVA and AVB’s calcium signals. hpEx4081 can be maintained by picking animals with weak pharyngeal RFP signals (seems to be a common artifact of the Cre-LoxP system).
ZM11086 C. elegans hpEx4362. Show Description
hpEx4362 [flp-18p::cha-1(sense) + twk-40p::cha-1(antisense) + ttx-3p::GFP]. Pick animals with GFP expression in AIY to maintain. Transgenic animals exhibit reduced forward speed and body bending; this phenotype is not fully penetrate.
ZM11284 C. elegans twk-40(bln336) III; hpEx4479. Show Description
hpEx4479 [npr-4p::snb-1::pHluorin + lin-15(+)]. Pick animals with green fluorescence in VNC to maintain. twk-40(bln336) is a gain-of-function allele. Paralyzed; no backward movement upon head touch. Synapse exocytosis marker for AVA. Transgenic animals exhibit punctate fluorescent signals along AVA neurites in the ventral cord, with weaker expression than in a wild-type background.
ZM11285 C. elegans twk-40(hp834) III; hpEx4479. Show Description
hpEx4479 [npr-4p::snb-1::pHluorin + lin-15(+)]. Pick animals with green fluorescence in VNC to maintain. twk-40(hp834) is a loss-of-function allele. Loopy. Synapse exocytosis marker for AVA. Transgenic animals exhibit punctate fluorescent signals along AVA neurites in the ventral cord, with stronger expression than in a wild-type background.
ZM8230 C. elegans ubr-1(hp684) I. Show Description
hp684(Q1864X) mutant animals generate reversal movement with little flexing of the posterior body, and the stiffness is prominent during prolonged reversals. This phenotype is progressive, and most prominent when animals develop from the L4 stage larvae into adults. Reference: Chitturi JH, et al. PLoS Genetics. 2018;14(4):e1007303.
ZM8561 C. elegans daf-2(m596) III; hpEx2906. Show Description
hpEx2906 [myo-2p::RFP + rgef-1p::daf-2]. Transgenic worms dauer easily. Pick RFP+ animals to maintain. [NOTE: (07-14-2015) The genotype of this strain was incorrectly reported as daf-2(e1370), but is in fact daf-2(m596).] References: Hung W, et al. EMBO J. 2013 Jun 12;32(12):1745-60. Hung W, et al. Development. 2014 Apr;141(8):1767-79.
ZM8562 C. elegans daf-2(m596) III; hpEx3369. Show Description
hpEx3369 [myo-2p::RFP + ges-1p(short)::daf-2]. Transgenic worms do not dauer. Pick RFP+ animals to maintain. [NOTE: (07-14-2015) The genotype of this strain was incorrectly reported as daf-2(e1370), but is in fact daf-2(m596).] References: Hung W, et al. EMBO J. 2013 Jun 12;32(12):1745-60. Hung W, et al. Development. 2014 Apr;141(8):1767-79.
ZM8988 C. elegans daf-2(m596) III; hpEx2908. Show Description
hpEx2908 [myo-2p::RFP + dpy-30p::daf-2]. Transgenic worms do not dauer. Pick RFP+ animals to maintain. [NOTE: (07-14-2015) The genotype of this strain was incorrectly reported as daf-2(e1370), but is in fact daf-2(m596).] References: Hung W, et al. EMBO J. 2013 Jun 12;32(12):1745-60. Hung W, et al. Development. 2014 Apr;141(8):1767-79.
ZM9028 C. elegans daf-2(m596) III; hpEx2905. Show Description
hpEx2905 [myo-2p::RFP + myo-3p::daf-2]. Pick RFP+ to maintain. Maintain at 15C. Temperature sensitive dauer constitutive. [NOTE: (07-14-2015) The genotype of this strain was incorrectly reported as daf-2(e1370), but is in fact daf-2(m596).] References: Hung W, et al. EMBO J. 2013 Jun 12;32(12):1745-60. Hung W, et al. Development. 2014 Apr;141(8):1767-79.
ZM9474 C elegans flp-14(gk1055) III; hpSi38. Show Description
hpSi38 [flp-14(+) + NeoR]. Superficially wild-type. Neomycin-resistant. hpSi38 is a single copy miniMos insertion a wild-type genomic fragment containing flp-14 and fully rescues the flp-14 mutant phenotype. Reference: Lim MA, et al. Elife. 2016 Nov 18;5:e19887. doi: 10.7554/eLife.19887. PMID: 27855782
ZM9519 C. elegans flp-14(gk1055) III; hpSi38; hpIs201. Show Description
hpSi38 [flp-14(+) + NeoR]. hpIs201[ceh-10p::GFP + lin-15(+)]. GFP expression in RID neuron. Neomycin-resistant. hpSi38 is a single copy miniMos insertion a wild-type genomic fragment containing flp-14 and fully rescues the flp-14 mutant behavioral defects and RID axon defects. Reference: Lim MA, et al. Elife. 2016 Nov 18;5:e19887. doi: 10.7554/eLife.19887. PMID: 27855782
ZM9583 C. elegans unc-2(hp858) X. Show Description
GFP tag inserted at the N-terminus (immediately in front of the ATG start codon) of the unc-2 locus specifically tagging the UNC-2B isoform. hp858 animals exhibit wildtype motor behaviors. Reference: Gao S, et al. eLife 2018 Jan 23;7:e29915. PMID: 29360035
ZR2 C. elegans jmjd-3.1(gk384) X. Show Description
Gonadal enlargement and aberrant gonad migration. Phenotype evident at 25C.
ZT3 C. elegans csr-1(fj54) IV/nT1 [qIs51] (IV;V). Show Description
Heterozygotes are wild-type with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP csr-1(fj54) homozygotes (sterile, but some animals lay a small number of dead eggs). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. The fj54 mutation deletes a 524 bp region including half of the second exon, the third exon, and almost all of the fourth exon, causing a frame shift to stop the translation of both PAZ and Piwi domains. The deletion can be checked by PCR with the following primers: AAGAAATACCAATGCGGAGGCA and TTCACGGCTCTTTGCAGTTTCA.
ZT33 C. elegans cec-8(fj63) III. Show Description
No apparent phenotype. The chromodomain protein CEC-8 is phylogenetically similar to CEC-5 and CEC-4. fj63 is a 14-bp deletion located in the region of the gene corresponding to the N-terminus of CEC-8 (Y55B1BR.3). The fj63 deletion can be detected by PCR with the following primers: GCTGTATAATACTCACTATGTC and TCCAGCTCTGTAACCTTGAA. Reference: Tabara H, et al. (2023) A small RNA system ensures accurate homologous pairing and unpaired silencing of meiotic chromosomes. EMBO J, e105002.
ZT36 C. elegans ego-1(om58) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
Heterozygotes are WT and GFP+ and segregate WT GFP+ heterozygotes, non-GFP ego-1 homozygotes (sterile with inaccurate homologous pairing of meiotic chromosomes), very rare GFP+ homozygous hT2, and dead eggs. Maintain by picking wild-type GFP+. Reference: Tabara H, et al. (2023) A small RNA system ensures accurate homologous pairing and unpaired silencing of meiotic chromosomes. EMBO J, e105002.
ZT46 C. elegans csr-1(fj67) IV/nT1 [qIs51] (IV;V). Show Description
Heterozygotes are wild-type with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP csr-1(fj67) homozygotes (sterile, but some animals lay a small number of dead eggs). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. Intracellular localization of CSR-1 is abnormal in the csr-1(fj67) homozygotes. fj67 is a 60-bp in-frame deletion of the first lysine-rich region (KQKDNFILLDILLKQWAAKK) in CSR-1. The first lysine-rich region in the WT has a FokI site. The deletion can be checked by PCR with the following primers: CACCTGTGATTTTTCGGGGAAC and TGGATTCCTTTTGCTGCAACAG, followed by digestion with FokI. Reference: Tabara H, et al. (2023) A small RNA system ensures accurate homologous pairing and unpaired silencing of meiotic chromosomes. EMBO J, e105002.
ZT47 C. elegans csr-1(fj70) IV/nT1 [qIs51] (IV;V). Show Description
Heterozygotes are wild-type with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP csr-1(fj70) homozygotes (sterile, but some animals lay a small number of dead eggs). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. fj70 is a D769L mutation that renders CSR-1 (an Argonaute protein) catalytically defective and generates a new SphI site. The fj70 mutation can be checked by PCR with the following primers: TACACGTGGATGATGAGAAG and TCGTCCGAAACTTCCTCATC, followed by digestion with SphI. Homozygous nT1[qIs51] inviable. Reference: Tabara H, et al. (2023) A small RNA system ensures accurate homologous pairing and unpaired silencing of meiotic chromosomes. EMBO J, e105002.
ZT49 C. elegans ego-1(fj114[PA::ego-1]) I. Show Description
Four amino-acid residues (G24–V27) near the N-terminus of EGO-1 were replaced with a PA-tag sequence (GVAMPGAEDDVV derived from human podoplanin) in the endogenous ego-1 gene. The PA-tag insertion can be checked by PCR with the following primers: TTCAAAATGCCGCTGCCTTC and GTCCTCTTCGCATCTTTATCAG, followed by digestion with Sau96I. The wild-type ego-1 gene contains a Sau96I site within its PCR region, while the PA-tagged ego-1 does not. This strain was used for immunofluorescence analysis of EGO-1. Reference: Tabara H, et al. (2023) A small RNA system ensures accurate homologous pairing and unpaired silencing of meiotic chromosomes. EMBO J, e105002.
ZT57 C. elegans csr-1(fj126) IV/nT1 [qIs51] (IV;V). Show Description
Heterozygotes are wild-type with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP csr-1(fj126) homozygotes (sterile, but some animals lay a small number of dead eggs). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. fj126 was generated by the insertion of a synthetic nuclear export signal (NES). Instead of six amino-acid residues (R8–I13) near the N-terminus of CSR-1b, an NES sequence (LNELALKLAGLDI) from the cAMP-dependent protein kinase inhibitor alpha in mammals was inserted into the endogenous csr-1 gene. The DNA sequence encoding the NES has a HindIII site. The fj126 mutation can be checked by PCR with the following primers: AAGAAATACCAATGCGGAGGCA and CCGCTGAGGAACGAGATGG, followed by digestion with HindIII. Reference: Tabara H, et al. (2023) A small RNA system ensures accurate homologous pairing and unpaired silencing of meiotic chromosomes. EMBO J, e105002.
ZT60 C. elegans csr-1(fj54)/tmC5 [F36H1.3(tmIs1220)] IV. Show Description
Sterile csr-1 allele balanced over tmC5 labelled with Venus. Heterozygotes are wild-type with somewhat dimmer Venus signal and segregate WT Venus(+) heterozygotes, Mec Unc Venus(+) tmC5 homozygotes, and non-Venus csr-1(fj54) homozygotes (sterile, but some animals lay a small number of dead eggs). Pick wild-type Venus(+) and check for proper segregation of progeny to maintain. Homologous pairing and unpaired silencing of meiotic chromosomes are inaccurate in this csr-1 null-mutant homozygotes. The fj54 deletion causes a frame-shift to stop the translation of both PAZ and Piwi domains. The deletion can be checked by PCR with the following primers: AAGAAATACCAATGCGGAGGCA and TTCACGGCTCTTTGCAGTTTCA. The inversion-based balancer in ZT60 is more amenable to producing csr-1(fj54) homozygous males than a translocation-based balancer (ZT3). Reference: Tabara H, et al. (2023) A small RNA system ensures accurate homologous pairing and unpaired silencing of meiotic chromosomes. EMBO J, e105002.
ZT61 C. elegans vsra-1(tm1637) I; csr-1(fj54)/tmC5 [F36H1.3(tmIs1220)] IV. Show Description
Sterile csr-1 allele balanced over tmC5 labelled with Venus. Heterozygotes are wild-type with somewhat dimmer Venus signal and segregate WT Venus(+) heterozygotes, Mec Unc Venus(+) tmC5 homozygotes, and non-Venus csr-1(fj54) homozygotes (sterile, but some animals lay a small number of dead eggs). Pick wild-type Venus(+) and check for proper segregation of progeny to maintain. Homologous pairing and unpaired silencing of meiotic chromosomes are inaccurate in homozygous tm1637; fj54 double mutants. The vsra-1 mutation enhances the defects caused by the csr-1 mutation. The fj54 deletion causes a frame-shift to stop the translation of both PAZ and Piwi domains. tm1637 can be detected by PCR with the following primers: AAGCAGTTCTTCAAGACTGGTC and TTGTCCACTCGCACTTTGTG. The fj54 deletion can be checked by PCR with the following primers: AAGAAATACCAATGCGGAGGCA and TTCACGGCTCTTTGCAGTTTCA. vsra-1 is also known as csr-2/C04F12.1. Reference: Tabara H, et al. (2023) A small RNA system ensures accurate homologous pairing and unpaired silencing of meiotic chromosomes. EMBO J, e105002.
ZT65 C. elegans him-1(e879) I; fjDf1 fjDf2 fjDf3 fjDf4 X. Show Description
The CeRep55_X quadruple-deletion mutant does not exhibit a clear Him phenotype, but the Him phenotype of the him-1(e879) mutant is enhanced by the CeRep55_X quadruple deletions. CeRep55 quadruple deletion: fjDf1 (also known as fj115); fjDf2 (aka fj85); fjDf3 (aka fj123); fjDf4 (aka fj120) X. This strain lacks four major clusters of CeRep55 repeats on the X chromosome. The condensation of unpaired X chromosomes in male testes is insufficient. CeRep55 is a class of minisatellite sequences consisting of a 27-nt tandem repeat that is present on all chromosomes. Some CeRep55 clusters express long non-coding RNAs and small RNAs. Each of the four deletion sites was designed to acquire a sequence tag (TGTACAGGAAACAGCTATGACC; similar to M13 reverse) instead of the CeRep55 tandem repeats. The deletions of CeRep55 clusters can be checked by PCR with the following primers: fjDf1 in Y73B3A, AGTAGTTACAAAGCGATATACGAAC and TTCGCCGACTCATAGACATCTG; fjDf2 in Y75D11A, CAAGTGCCAAACTAGACTGCTC and TTCAAAACGCTACGCGATACCAG; fjDf3 in Y81B9A, AAATGCCCCTATCTCACAGTGG and GACTGCTAGAATCTGACTCGTC; fjDf4 in Y49A10A, CTCTTCCATTTCCAGTACAACCAG and GTTTCTATGGCTAGAGTCGTATGGTTAC. The PCR check can also be performed with the M13 reverse primer and the right-side primer. The e879 mutation can be checked by PCR with the following primers: AAATCAGGAGTGGGCATCAG and GGGAAGATTCCGATGAGTGA, followed by digestion with MvaI. The wild-type him-1 gene contains an MvaI site within its PCR region, while the e879 allele does not. Reference: Tabara H, et al. (2023) A small RNA system ensures accurate homologous pairing and unpaired silencing of meiotic chromosomes. EMBO J, e105002.
ZT69 C. elegans csr-1(fj162) IV; fjDf1 fjDf2 fjDf3 fjDf4 X. Show Description
fj162 at the second K-rich region is an in-frame duplication (comprising of a small duplication and a tiny inverted duplication) generating 61 extra amino acids. The CeRep55_X quadruple-deletion mutant does not exhibit a clear Him phenotype, but the Him phenotype of the csr-1(fj162) mutant is enhanced by the CeRep55_X quadruple deletions. The fj162 mutation can be checked by PCR with the following primers: TCGGATGTTGACTACAACGC and GAAGGTAGAAACTTCATTCCAGCAC. This strain lacks four major clusters of CeRep55 repeats on the X chromosome. The condensation of unpaired X chromosomes in male testes is insufficient. CeRep55 is a class of minisatellite sequences consisting of a 27-nt tandem repeat that is present on all chromosomes. Some CeRep55 clusters express long non-coding RNAs and small RNAs. Each of the four deletion sites was designed to acquire a sequence tag (TGTACAGGAAACAGCTATGACC; similar to M13 reverse) instead of the CeRep55 tandem repeats. The deletions of CeRep55 clusters can be checked by PCR with the following primers: fjDf1 in Y73B3A, AGTAGTTACAAAGCGATATACGAAC and TTCGCCGACTCATAGACATCTG; fjDf2 in Y75D11A, CAAGTGCCAAACTAGACTGCTC and TTCAAAACGCTACGCGATACCAG; fjDf3 in Y81B9A, AAATGCCCCTATCTCACAGTGG and GACTGCTAGAATCTGACTCGTC; fjDf4 in Y49A10A, CTCTTCCATTTCCAGTACAACCAG and GTTTCTATGGCTAGAGTCGTATGGTTAC. The PCR check can also be performed with the M13 reverse primer and the right-side primer. Reference: Tabara H, et al. (2023) A small RNA system ensures accurate homologous pairing and unpaired silencing of meiotic chromosomes. EMBO J, e105002.
ZW127 C. elegans zwIs106. Show Description
zwIs106 contains [unc-9p::GFP + lin-15(+)]. Superficially wild-type. Maintain under normal conditions. Described in Altun et al. Dev Dyn 238:1936-50 (2009).
ZX2604 C. elegans sng-1(ok234) X; zxIs127. Show Description
zxIs127 [sng-1p::SNG-1::CRY2olig(535) + myo-2p::mCherry]. Strain should be kept in the dark; it is very light-sensitive. Pan-neuronal expression of a truncated variant of Arabidopsis thaliana Cryptochrome-2 fused to synaptogyrin. If illuminated with blue light, synaptic vesicles cluster, resulting in inhibition of synaptic transmission. Synaptic transmission is restored within 15 minutes in the absence of light (ca. 6.5min time constant), resulting in normal wild type behavior afterwards. Reference: Vettkotter D, et al. Nat Commun 13, 7827 (2022). https://doi.org/10.1038/s41467-022-35324-z. PMID: 36535932
ZZ15 C. elegans lev-8(x15) X. Show Description
Pseudowild levamisole resistance. Head more resistant than body. Body resistance is temperature sensitive. WT phenotype.
ZZ16 C. elegans lev-9(x16) X. Show Description
Pseudo wild type levamisole resistance. WT phenotype.
ZZ17 C. elegans lev-10(x17) I. Show Description
Pseudo wild type levamisole resistant. WT phenotype. pka lev-10.
ZZ21 C. elegans lev-1(x21) tra-3(e2333) IV. Show Description
Levamisole resistant. Unc. tra-3 mutation discovered late. See Hodgkin & Barnes 1991 for genotype details.