Search Strains

tnEx37 [acy-4(+) + sur-5::GFP]. Pick GFP+ animals to maintain. tnEx37 rescues acy-4(ok1806) sterility. Reference: Kim S, et al. 2012 Genetics

sacy-1(tn1385) partially suppresses fog-2(oz40) self-sterility. Reference: Kim S, et al. 2012 Genetics

tnEx159 [sacy-1p::GFP::sacy-1 + unc-119(+)]. Pick wild-type to maintain. Transgene rescues sacy-1(tm5503) sterility. Reference: Kim S, et al. 2012 Genetics

Homozygous ok2424 animal are viable and fertile, but will go sterile in successive generations. Homozygous sterile deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok2424 homozygotes (superficially wild-type with some sterility). Homozygous hT2[bli-4 let-? qIs48] inviable. Maintain by picking GFP+ heterozygotes and checking for correct segregation of progeny to maintain a balanced stock. Derived from parental strain RB1874, originally provided to the CGC by the OMRF Knockout Group, part of the International C. elegans Gene Knockout Consortium. Paper_evidence WBPaper00041807

DH subclone of C. briggsae Zuckerman. This stock was maintained in liquid culture for some number of years, and has acquired mutations that have not been named or mapped. It is Unc, dauer-defective and ts lethal. Previously called C. briggsae BO. For whole-genome sequence-verified wild strains, please request from the Caenorhabditis Natural Diversity Resource (www.caendr.org).

Low brood size and incompletely penetrant embryonic lethality. Accumulates yolk in the pseudocoelom of adult hermaphrodites. Males are normal.

Interfertile with N2. Survives freezing lin liquid nitrogen. Temperature sensitive. Brood size like N2. Generation time like N2. Spontaneous males. Reference WBG 10(2) 140-141. Isolated in El Prieto Canyon, CA. Caenorhabditis elegans wild isolate (Tc1 pattern HCC). For whole-genome sequence-verified wild strains, please request from the Caenorhabditis Natural Diversity Resource (www.caendr.org).

C. elegans wild isolate. Reference: Andersen EC, et al. Nat Genet. 2012 Jan 29;44(3):285-90. For whole-genome sequence-verified wild strains, please request from the Caenorhabditis Natural Diversity Resource (www.caendr.org).

C. elegans wild isolate. Reference: Andersen EC, et al. Nat Genet. 2012 Jan 29;44(3):285-90. For whole-genome sequence-verified wild strains, please request from the Caenorhabditis Natural Diversity Resource (www.caendr.org).

C. elegans wild isolate. Reference: Andersen EC, et al. Nat Genet. 2012 Jan 29;44(3):285-90. For whole-genome sequence-verified wild strains, please request from the Caenorhabditis Natural Diversity Resource (www.caendr.org).

sup-35 rescues synthetic lethality of ubc-18 and pha-1.

Superficially wild-type. sup-36 suppresses temperature-sensitive lethality of pha-1(e2123). Constructed by crossing GE24 and MT14541.

sup-36 suppresses synthetic lethality and Pun phenotype of ubc-18(tm5426) animals grown on ubc-3 RNAi.

DLM 19: sup-37 suppresses synthetic lethality and Pun phenotype of ubc-18(tm5426) animals grown on ubc-3 RNAi.

otIs197 [unc-14p::hif-1(P621A) + ttx-3p::RFP]. Non-degradable form of HIF-1 expressed from unc-14 promoter in hif-1 mutant background for tissue-specific rescuing experiments. otIs197 rescues lethality in hif-1 mutant animals exposed to 50ppm hydrogen sulfide. Reference: Topalidou I & and Miller DL. bioRxiv 174581; doi: https://doi.org/10.1101/174581.

otEx3165 [unc-120p::hif-1(P621A) + ttx-3p::RFP]. Non-degradable form of HIF-1 expressed from muscle-specific promoter in hif-1 mutant background for tissue-specific rescuing experiments. otEx3165 does not rescue lethality in hif-1 mutant animals exposed to 50ppm hydrogen sulfide. Reference: Topalidou I & and Miller DL. bioRxiv 174581; doi: https://doi.org/10.1101/174581.

Suppressed Unc-52. This strain was isolated after EMS mutagenesis of CB998 and subjected to whole-genome sequencing (Flibotte et al., Genetics 185: 431 - 441 (2010). In addition to the unc-52 and sup-38 mutations, it is homozygous for 300 other mutations determined from sequence data. All mutations are annotated in WormBase. The e3003 and e998 mutations were present in the original CB998 strain. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00036200

Y102F5A.1. Deletion extents determined by oligo array CGH. Deletion size: ~14kb. Deletion left flank: GGCAATCCTGGCCGAAGCTTTGAAACGCCCGAGTAAAGCCAAGAAGCGTC. Deletion right flank: GTTGTCTTTATCGAACCGCGTTGTTGAACTGTTGCATGAATCATGATTTC. This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. URL: http://www.celeganskoconsortium.omrf.org.

C47E8.7. Heterozygotes are WT and segregate WT, Pat unc-112 homozygotes and Unc homozygotes. Pick WT to maintain. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

ZC101.2a. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

raEx335 [pxl-1a::GFP + rol-6(su1086)]. Rollers. Transgene rescues ok1483 L1 lethality. Pick adults to maintain. Reference: Warner A, et al. Mol Biol Cell. 2011 Jul 15;22(14):2551-63.

raEx438 [pxl-1p::pxl-1a(cDNA)::GFP + rol-6(su1086)]. Rollers. Transgene does not rescue ok1483 L1 lethality. Transgenic (Rol) heterozygotes segregate rolling non-Dpy (heterozygotes carrying raEx438), non-rolling non-Dpy (heterozygotes without the array), arrested L1 (ok1483 homozygotes) and sterlie Dpy (mT1 homozygotes). Pick rolling non-Dpy and check for correct segregation of progeny to maintain. Reference: Warner A, et al. Mol Biol Cell. 2011 Jul 15;22(14):2551-63.

For PCR STS mapping. Differs from RW7000 in two Tc1 sites. Caenorhabditis elegans wild isolate. DP subclone of RW7000. For whole-genome sequence-verified wild strains, please request from the Caenorhabditis Natural Diversity Resource (www.caendr.org).

Homozygotes for this mutation express a dumpy phenotype, while heterozygotes are roller and slightly shorter-than-wildtype in length. This Ctr-dpy-10 mutation will serve as a suitable syntenic marker for chromosome II mutations in C. tropicalis that does not impact the viability or fecundity of the organism. Generated in a C. tropicalis JU1373 background. Hermaphrodite. Culture at 20°C or above.

bmdSi284 [loxN::rpl-28p::TIR1(F79G)::T2A::DHB::2xmKate2] I. bmdSi284 is a single copy CRISPR/Cas9 insertion that ubiquitously co-expresses the mutant version of TIR1 for improved auxin-inducible degradation via 5-Ph-IAA and a CDK activity sensor consisting of a fragment of human DNA helicase B (DHB) fused to two copies of mKate2. Reference: Martinez MAQ, et al. Biology Open. 2022 Dec 15;11(12):bio059668. doi: 10.1242/bio.059668.

bmdSi297 [loxN::rpl-28p::FRT3::STOP::FRT3::TIR1(F79G)::T2A::DHB::2xmKate2]; inserted into safe harbor site ttTi5605 in Chr II. Ubiquitous rpl-28 promoter driving expression of FRT3::STOP::FRT3::TIR1(F79G)::DHB construct dependent upon tissue-specific FLPase. High levels of TIR1(F79G) can be expressed in specific tissue or cell types via FLPase activity, allowing spatiotemporally-targeted degradation of AID-tagged proteins. Reference: Xiao Y, et al. An expandable FLP-ON::TIR1 system for precise spatiotemporal protein degradation in C. elegans. bioRxiv 2022.10.14.512315; doi: https://doi.org/10.1101/2022.10.14.512315

bmdSi346 [loxN::lin-31p::FLP]; inserted into safe harbor site ttTi4348 in Chr I. bmdSi297 [loxN::rpl-28p::FRT3::STOP::FRT3::TIR1(F79G)::T2A::DHB::2xmKate2]; inserted into safe harbor site ttTi5605 in Chr II. FLP-ON::TIR1 system for AID-tagged protein degradation in VPCs. High levels of TIR1(F79G) expression in vulval precursor cells by lin-31p::FLP with co-expression of CDK activity sensor. bmdSi297 contains the ubiquitous rpl-28 promoter driving expression of FRT3::STOP::FRT3::TIR1(F79G)::DHB construct dependent upon tissue-specific FLPase. High levels of TIR1(F79G) can be expressed in specific tissue or cell types via FLPase activity, allowing spatiotemporally-targeted degradation of AID-tagged proteins. Reference: Xiao Y, et al. An expandable FLP-ON::TIR1 system for precise spatiotemporal protein degradation in C. elegans. bioRxiv 2022.10.14.512315; doi: https://doi.org/10.1101/2022.10.14.512315

bmdSi348 [loxN::rgef-1p::FLP::P2A::H2B::2xmTurq2]; inserted into safe harbor site ttTi4348 in Chr I. bmdSi362 [loxN::rpl-28p::FRT3-LCK::mNG-STOP::FRT3::TIR1(F79G)::2A::PH::2xmKate2]; inserted into safe harbor site ttTi5605 in Chr II. FLP-ON::TIR1 system for AID-tagged protein degradation in neurons. High levels of TIR1(F79G) expression in neurons by rgef-1p::FLP with co-expression of membrane markers. bmdSi362 contains the ubiquitous rpl-28 promoter driving expression of FRT3-LCK::mNG-STOP::FRT3::TIR1(F79G)::2A::PH::2xmKate2 construct dependent upon tissue-specific FLPase. High levels of TIR1(F79G) can be expressed in specific tissue or cell types via FLPase activity, allowing spatiotemporally-targeted degradation of AID-tagged proteins. Reference: Xiao Y, et al. An expandable FLP-ON::TIR1 system for precise spatiotemporal protein degradation in C. elegans. bioRxiv 2022.10.14.512315; doi: https://doi.org/10.1101/2022.10.14.512315

Reference WBG 10(2) 140-141. Previously called Bergerac LY and Bergerac BO. Caenorhabditis elegans wild isolate. DR subclone of Bergerac BO (Tc1 pattern HCA). For whole-genome sequence-verified wild strains, please request from the Caenorhabditis Natural Diversity Resource (www.caendr.org).

Reference WBG 10(2) 104-141 and 11(5) 60. Caenorhabditis elegans wild isolate. DR subclone of Cl2a (Tc1 pattern II). For whole-genome sequence-verified wild strains, please request from the Caenorhabditis Natural Diversity Resource (www.caendr.org).

Reference WBG 10(2) 140-141. Caenorhabditis elegans wild isolate. DR subclone of GA-1 (Tc1 pattern I). For whole-genome sequence-verified wild strains, please request from the Caenorhabditis Natural Diversity Resource (www.caendr.org).

Reference WBG 10(2) 140-141. Caenorhabditis elegans wild isolate. DR subclone of GA-1 (Tc1 pattern I). For whole-genome sequence-verified wild strains, please request from the Caenorhabditis Natural Diversity Resource (www.caendr.org).

Reference WBG 10(2) 140-141. Caenorhabditis elegans wild isolate. DR subclone of GA-1 (Tc1 pattern I). For whole-genome sequence-verified wild strains, please request from the Caenorhabditis Natural Diversity Resource (www.caendr.org).

Reference WBG 10(2) 140-141 and 11(5) 60. Caenorhabditis elegans wild isolate. DR subclone of PA-1. For whole-genome sequence-verified wild strains, please request from the Caenorhabditis Natural Diversity Resource (www.caendr.org).

Reference WBG 10(2) 140-141. Caenorhabditis elegans wild isolate. DR subclone of PA-2 (Tc1 pattern III). For whole-genome sequence-verified wild strains, please request from the Caenorhabditis Natural Diversity Resource (www.caendr.org).

Egl phenotype, viable. Lethality and Daf-c phenotype of m333 suppressed by daf-16 (m333 alone is a maternal-effect non-conditional dauer constitutive). age-1(m333) pka daf-23(m333).

Approximately 30% dauer at 27C. Probably thermotolerant because it comes from a thermotolerant selection, but it was not retested. Increaesed longevity. Maintain at 15C.

Paralyzed Unc. sus-1 suppresses the ability of eDp23 to suppress unc-15. eDp23 = sup-3(e1407).

sup-7 suppresses unc-13. Movement not WT. Fertility is low. Grows between 22.5C and 24C.

Unc. Weakly semi-dominant. Scored with difficulty.

Temperature sensitive dauers. Paralyzed Unc. sus-1 suppresses the ability of eDp23 to suppress unc-15. eDp23 = sup-3(e1407).

Green nuclei and ubiquitous cytosolic red expression, typically excluded from nuclei but with activity-dependent translocation into nuclei. Derived in an N2 background. C-terminally tagged mpk-1 is detectable by triplex PCR: mpk-1 genotyping FW: ACCAAAACAACCATGGGCTCG mpk-1 genotyping RV-1: GCTCCAAGTATGGGTGAGCC mpk-1 genotyping RV-2: GGTTCCCTCGTATGGCTTTCC Reference: Neal R, et al. (2021). Nuclear translocation of tagged endogenous ERK/MPK-1 MAP Kinase denotes a subset of activation events in C. elegans development.

Originally from ecological study at University of GA. Identification by E. Mae Noffsinger.

eeeIs2 [unc-54p::Htt513(Q128)::YFP::unc-45 3'UTR]. Motility defect. YFP expression in body wall muscle cells. YFP is fused to a fragment of mutant human Huntingtin protein. Reference: Lee AL. et al. PLoS One. 2017 Mar 10;12(3):e0173644. [NOTE: The transgene in this strain was previously described as using the unc-45 promoter, but it is actually the unc-54 promoter.]

Caenorhabditis elegans wild isolate. Isolated from a compost bin from a West Mains allotment public vegetable garden near Edinburgh Scotland on Dec. 19, 2005. Haplotype (according to Cutter 2006 and Dolgin et al 2008): J. Reference: Andersen EC, et al. Nat Genet. 2012 Jan 29;44(3):285-90. For whole-genome sequence-verified wild strains, please request from the Caenorhabditis Natural Diversity Resource (www.caendr.org).

Caenorhabditis elegans wild isolate. Isolated from a compost bin from a Midmar Allotment public vegetable garden (field 1 plot 39) near Edinburgh Scotland on Nov. 26, 2005. Haplotype (according to Cutter 2006 and Dolgin et al 2008): A. For whole-genome sequence-verified wild strains, please request from the Caenorhabditis Natural Diversity Resource (www.caendr.org).

Caenorhabditis elegans wild isolate. Isolated from a compost bin from a Midmar Allotment public vegetable garden (field 1 plot 39) near Edinburgh Scotland on Nov. 26, 2005. Haplotype (according to Cutter 2006 and Dolgin et al 2008): J. For whole-genome sequence-verified wild strains, please request from the Caenorhabditis Natural Diversity Resource (www.caendr.org).

Maintain under normal conditions. Reference: Andersen EC, Nat Genet. 2012 Jan 29;44(3):285-90. For whole-genome sequence-verified wild strains, please request from the Caenorhabditis Natural Diversity Resource (www.caendr.org).

Caenorhabditis elegans wild isolate. Isolated from a compost bin from a Midmar Allotment public vegetable garden (field 1 plot 39) near Edinburgh Scotland on Dec. 3, 2005. Haplotype (according to Cutter 2006 and Dolgin et al 2008): A. For whole-genome sequence-verified wild strains, please request from the Caenorhabditis Natural Diversity Resource (www.caendr.org).

Caenorhabditis elegans wild isolate. Isolated from a compost bin from a Midmar Allotment public vegetable garden (field 1 plot 39) near Edinburgh Scotland on Dec. 19, 2005. Haplotype (according to Cutter 2006 and Dolgin et al 2008): N. For whole-genome sequence-verified wild strains, please request from the Caenorhabditis Natural Diversity Resource (www.caendr.org).