Search Strains

Engineered null mutations in predicted GPCR genes. Reference: Pu L, et al. Nat Commun. 2023 Dec 18;14(1):8410. PMID: 38110404.

Engineered null mutations in predicted GPCR genes. Reference: Pu L, et al. Nat Commun. 2023 Dec 18;14(1):8410. PMID: 38110404.

Engineered null mutations in predicted GPCR genes. Reference: Pu L, et al. Nat Commun. 2023 Dec 18;14(1):8410. PMID: 38110404.

Engineered null mutations in predicted GPCR genes. Reference: Pu L, et al. Nat Commun. 2023 Dec 18;14(1):8410. PMID: 38110404.

Engineered null mutations in predicted GPCR genes. Reference: Pu L, et al. Nat Commun. 2023 Dec 18;14(1):8410. PMID: 38110404.

juIs76 [unc-25p::GFP + lin-15(+)] II. GFP expression in GABAergic motor neurons. [NOTE: (10/11/2018) CZ13799 was sent as a replacement for CZ1200, which was found to carry background mutations affecting neuron morphology.] Derived by outcrossing CZ1200 to remove lin-15(n765) and unidentified background mutations. Reference (for original juIs76 strain): Huang X, et al. Neuron. 2002 May 16;34(4):563-76.

juSi164 [mex-5p::HIS-72::miniSOG + Cbr-unc-119(+)] III. Maintain in the covered box to avoid unnecessary exposure to ambient light. Wild-type behavior in movement, mating, growth and brood size. Upon blue light treatment (460 nm LED light for 30 min at 4 Hz with 2 mW/mm2), Histone-miniSOG in the germline can induce heritable mutations. Wild-type behavior in movement, mating, growth and brood size. MosSCI insertion into oxTi444 on Chr. III. Reference: Noma K & Jin Y. Nature Communications, 2015.

Temperature sensitive sterility: maintain at 15-20C. prg-1(ju1574) mutant animals become sterile at the fifth generation grown at 25C. prg-1(ju1574) contains two mutations in the PIWI domain active site (RNaseH/slicer) [D583A, Y585A]. Mutation of the first conserved aspartate of the catalytic triad (D-D-H motif) to alanine (D583A) created an A-D-H motif which abolishes slicer activity in Argonaute proteins. WT: [GTCGGCTACGATCTGTACCACGACTCGACATTGAAAGGAAAAACT --> VGYDLYHDSTLKGKT] ju1574: [GTCGGCTACGcgCTGgctCAtGAtTCGACATTGAAAGGAAAAACT --> CGYALAHDSTLKGKT] Forward genotyping primer: GTAATGCTCGCTGACGACAA Reverse genotyping primer: TTGACGAACTGTGGAACCAA Reference: Kim KW, et al. Neuron. 2018 Feb 7;97(3):511-519.e6. doi: 10.1016/j.neuron.2018.01.014.

DH subclone of C. briggsae Zuckerman. This stock was maintained in liquid culture for some number of years, and has acquired mutations that have not been named or mapped. It is Unc, dauer-defective and ts lethal. Previously called C. briggsae BO. For whole-genome sequence-verified wild strains, please request from the Caenorhabditis Natural Diversity Resource (www.caendr.org).

Suppressed Unc-52. This strain was isolated after EMS mutagenesis of CB998 and subjected to whole-genome sequencing (Flibotte et al., Genetics 185: 431 - 441 (2010). In addition to the unc-52 and sup-38 mutations, it is homozygous for 300 other mutations determined from sequence data. All mutations are annotated in WormBase. The e3003 and e998 mutations were present in the original CB998 strain. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00036200

Homozygotes for this mutation express a dumpy phenotype, while heterozygotes are roller and slightly shorter-than-wildtype in length. This Ctr-dpy-10 mutation will serve as a suitable syntenic marker for chromosome II mutations in C. tropicalis that does not impact the viability or fecundity of the organism. Generated in a C. tropicalis JU1373 background. Hermaphrodite. Culture at 20°C or above.

Made by outcrossing HE110 four times. su110 is moderately Smg suppressible: HE110 animals are significantly less Unc than DV2208, and HE110 animal are also pVul, which is characteristic of Smg mutations.

Dpy suppresses Rol and Lon. Strain appears to be only Dpy. Useful for mapping, especially Unc mutations. Separately, dpy-5 causes extreme dumpiness, rol-6 causes worms to roll over and lie in a "C" shape, and lon-1 worms are about 125% WT length.

Dpy suppresses Bli and Lon. Strain appears to be only slightly Dpy. Useful for mapping, especially Unc mutations. Separately, dpy-11 causes dumpiness, bli-6 adult worms develop blisters on their bodies, and lon-2 worms are about 150% WT length.

Unc. Not caused by cxTi10882. EG5003 contains background mutations (partial deletion of pgp-6 and pgp-7 and a deletion close to cTel3x.1). EG6250 is an outcrossed version of this strain. Mos1 allele generated by NemaGENETAG consortium (Laurent Segalat).

ijmSi3 [mex-5p::cls-2(re-encoded)::GFP::tbb-2 3'UTR + Cbr-unc-119(+)] I. ltIs37 [pie-1p::mCherry::his-58 + unc-119(+)] IV. The coding sequence of GFP-tagged cls-2 in the transgene was re-coded using silent mutations to render it insensitive to RNAi-depletion of endogenous cls-2 expression. mCherry expression marks histones. Not known if unc-119(ed3) is still carried in the background of this strain. [NOTE: the ltIs37 [pie-1p::mCherry::his-58 + unc-119(+)] IV transgene was previously annotated as itIs37 in this strain. The correct name of the transgene is ltIs37 and not itIs37.] Reference: Schlientz A and Bowerman B. PLoS Genet. 2020 Oct 7;16(10):e1008751. doi: 10.1371/journal.pgen.1008751.

Temperature-sensitive, embryonic-lethal mutant that lacks a central spindle during early embryonic mitosis and exhibits a late cytokinesis defect (cleavage furrows regress after ingressing in nearly to the center of dividing embryonic cells). About 100% of embryos produced by homozygous mothers hatch at 15C; 0% hatch at 26C. ZEN-4 = vertebrate MKLP1 kinesin. There are two mis-sense mutations present in zen-4(or153). One is a D520N (GAC to AAC) and the other is D735N (GAT to AAT). Whether one or both is responsible for the phenotype is not know. Maintain at 15C. Shift L4s to 26 overnight to observe mutant phenotype on embyros produced by adults.

Long. Maintain at 15C. pha-1(e2123) is a temperature sensitive embryonic lethal. Strain viable only at 15C. lon-2 included to facilitate microinjection. Check regularly for ts lethality-spontaneous sup-35 mutations may occur!

Wild type at 15C. Embryonic lethal at 25C. Temperature sensitive phase during embryogenesis. sup-35 mutations may (and have) occurred spontaneously in this strain. This can be checked by shifting the worms to 25C: pha-1 animals should be dead while sup-35 pha-1 animals will live.

Sterile at 25C, maintain at 15C. NOTE (11/16/10 - J. Hubbard): This strain is NOT synonymous with glp-1(e2141) as previously reported in Kodoyianni V, Maine EM, Kimble J. (1992) [Molecular basis of loss-of-function mutations in the glp-1 gene of Caenorhabditis elegans. Mol Biol Cell. 3,1199-213. PMID: 1457827]. As reported in WBG article by Dalfó D, Priess J, Schnabel R and Hubbard J. (2010) [glp-1(e2141) sequence correction. The Worm Breeders Gazette. 18-3.], e2144 carries the mutation c2785t in exon 8, leading to the amino acid change L929F, whereas e2141 carries the mutations c2920t and a3610g in exon 8, leading to the amino acid changes R974C and T1204A.

zcIs13 [hsp-6p::GFP + lin-15(+)] V. Stable transgenic line with GFP expression mainly in the posterior intestine, observed from L1 to adult. Perturbation of mitochondrial folding environment induces robust GFP expression throughout the intestines. Derived by outcrossing parental strain SJ4100 to N2 six times to remove suspected background mutations causing uneven transgene expression and low penetrance of sterility.

Superficially wild-type. N-terminal tag of ATTF-2 via CRISPR/Cas9 knock-in of mNeonGreen at attf-2 locus. Insertion verified by PCR. Left flank: 5' cttttttgctcacatcatcatttttcagtc 3'; Right flank: 5' ATGTCGGCCGAGACCGCGACTATCCCCGAAGTTTC 3' (5 silent mutations). sgRNA: 5' CGAAACTGCAACCATACCCG 3'

N-terminal tag of CCDC-47 via CRISPR/Cas9 knock-in of mNeonGreen at ccdc-47 locus. Insertion verified by PCR, Sanger sequencing, and fluorescence. Left flank: 5' gttaaatcactcaatttcgggtcgttcacc 3'; Right flank: 5' ATGAAGATAGTATGGATTTTCCTAATATTC 3' (3 silent mutations); sgRNA: cgttcaccATGAAAATCGTC; Cas9/sgRNA plasmid: pGLOW13; mNG^SEC^3xFlag plasmid: pGLOW17; SEC insertion allele strain (balanced): GLW38.

N-terminal tag of EDC-3 via CRISPR/Cas9 knock-in of mNeonGreen at edc-3 locus. Insertion verified by PCR and fluorescence. Left flank: 5' ggttccaattcttctgatttcaaattaaaa 3'; Right flank: 5' ATGGATGACAAACTCATTGGAAGCGTCATCTCTACGGAGACAAAGGACGG 3' (7 silent mutations); sgRNA: ATATCAACCGAAACTAAAGA; Cas9/sgRNA plasmid: pGLOW81; mNG^SEC^3xFlag plasmid: pGLOW103; SEC insertion allele strain: GLW42.

Superficially wild-type. N-terminal tag of W08E12.7 via CRISPR/Cas9 knock-in of mNeonGreen at W08E12.7 locus. Insertion verified by PCR. Left flank: 5' ttcaatgtttattctttcagatagatcaaa 3'; Right flank: 5' ATGGTTAGAAAGGACAGTGAGAGTAGTTGTTCAAGTGATGG 3' (6 silent mutations). sgRNA: 5' GAAAGCAGCTGCTCCAGCGA 3'

N-terminal tag of H34C03.2 via CRISPR/Cas9 knock-in of mNeonGreen at H34C03.2 locus. Insertion verified by PCR and fluorescence. Left flank: 5' gggattgcctacactcaaatatacgtaacg 3'; Right flank: 5' ATGCCCACGCCGGAAGTGTTCCCATGGATG 3’ (4 silent mutations); gRNA: cgtaacgATGCCAACTCCCG; Cas9/sgRNA plasmid: pGLOW9; mNG^SEC^3xFlag plasmid: pGLOW106; SEC insertion allele strain: GLW72.

Slow growing. N-terminal tag of EEL-1 via CRISPR/Cas9 knock-in of mNeonGreen at eel-1 locus. Insertion verified by PCR. Left flank: 5' gacaagcgggttttttgaatcgtttcgaaa 3'; Right flank: 5' ATGAAGATTGACGATGCTGAGCCGAGCTCTAGTTCATCGGGCTCCGATAT 3' (6 silent mutations). sgRNA: 5' GACCCGGAAGAGCTTGAACT 3'

N-terminal tag of UBQL-1 via CRISPR/Cas9 knock-in of mScarlet at ubql-1 locus. Insertion verified by PCR and fluorescence. Genotyping primers: fwd – 5’ AGGGCGAGAGATTATCGGGA 3’; rev – 5’ CGGATCGTTGAGAATGTGTCC 3’. Left flank: 5' gtcggttttttaatatttctcaaatttaag 3'; Right flank: 5' ATGGCTACAGAGAGTGCACTCATCAAAGTTCACGTGAAATCACCCT 3’ (7 silent mutations); sgRNA: TCAACGTCATACTTGTTCGA; Cas9/sgRNA plasmid: pGLOW134; mScarlet^SEC^3xMyc plasmid: pGLOW145; SEC insertion allele strain: GLW88.

C-terminal tag of HRPA-1 via CRISPR/Cas9 knock-in of mScarlet at hrpa-1 locus. Insertion verified by PCR and fluorescence. Genotyping primers: fwd – 5’ GTCTCCACCAAACGCCTGTA 3’ ; rev – 5’ CTAGCCTGTGTCCCATCAGC 3’. Left flank: 5' AATGGGCCCACGCCCAGGGAGGAAACAGAAACTAT 3' (5 silent mutations); Right flank: 5' TAAattaattccttaagcccctctaagtgt 3’; sgRNA: CAGTGGGCTCATGCTCAAGG; Cas9/sgRNA plasmid: pGLOW144; mScarlet^SEC^3xMyc plasmid: pGLOW153; SEC insertion allele strain: GLW90.

Enhances retarded differentiation of the hypodermis and exit from the molting cycle caused by mutations in let-7 or its paralogs. Reference: Hayes GD, Frand AR, Ruvkun G. Development. 2006 Dec;133(23):4631-41.

syb762 is a 1076 bp deletion in nlp-8. Flanking sequences: taaaacccggaacc - acttcttgaacaactg Forward primer: TAAAAGCGGAGTAGCGTCCA Reverse primer: CAGATGGTCGGGTGATTTGA syb762 was generated in a mutant background and out-crossed to N2 to remove those background mutations. Reference: Sinner MP, et al. Curr Biol. 2021 Feb 8;31(3):564-577.e12. PMID: 33259791

Partially resistant to 400ug/ml NaF. Suppressor of the slow-growing phenotype of mutations in flr-1, flr-3, and flr-4.

Partially resistant to 400ug/ml NaF. Weakly Dpy. (Not determined if this is due to ut5 or a closely linked mutation.) Suppressor of the slow-growing phenotype of mutations in flr-1, flr-3, and flr-4. gpla-1 formerly known as flr-2.

mwEx32 [pat-3(YYFF) + sur-5::GFP]. Pick GFP+ to maintain. mwEx32 carries a mutant form of pat-3 gene with tyrosine (Y) to phenylalanine (F) mutations; rescues pat-3 null allele. Abnormal DTC migration. Reference: Lee M, et al. J Biol Chem. 2001 Sep 28;276(39):36404-10.

20% Maternal effect sterility on average, embryonic P granule defect, RNAi insensitivity. Engineered mutations in the endogenous meg-3 locus disrupt the binding and localization of PGL proteins to P granules in the early embryo while MEG-3 itself is still forms an asymmetric cytoplasmic gradient and granules. References: Smith, J. et al. Elife. 2016 Dec 3;5:e21337. doi: 10.7554/eLife.21337. PMID: 27914198 Schmidt H, bioRxiv 2020.10.15.340570 (2020) doi:10.1101/2020.10.15.340570.

Pick GFP+ to maintain. CRISPR-engineered RAM mutations in endogenous glp-1 locus with C-terminal 4xV5 tag. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP q1035 homozygotes (sterile). Homozygous hT2[bli-4 let-? qIs48] inviable. Maintain by picking GFP+ heterozygotes and checking for correct segregation of progeny to maintain a balanced stock. Derived by modification of parental strain JK5933 glp-1(q1000).

1xV5 tag inserted into endogenous gld-3 locus containing K864A & L867A engineered mutations, specifically tagging GLD-3L isoform. GLD-3L::1xV5 (K864A, L867A) animals are 30% Fog. Derived by CRISPR-engineered mutation of parental strain JK6091.

Phenotypically normal except that it does not show ges-1 activity. Mutations (ca6ca7) are presumably misense or nonsense but have not been characterized genetically.

vxEx725 [egl-1p::mCherry::egl-1(G55E, F65D)::egl-1 3'UTR + gcy-32p::GFP::unc-54 3'UTR + unc-122p::GFP]. Pick animals with GFP expression in coelomocytes to maintain. mCherry-tagged EGL-1 visible in URX adult neurons and apoptotic cells. G55E and F65D mutations in the BH3-only region to abolish mCherry::EGL-1 function in inducing cell death. Reference: Wu Z, et al. Proc Natl Acad Sci U S A. 2025 Jan 14;122(2):e2407909122. doi: 10.1073/pnas.2407909122. PMID: 39786930.

Brood size slightly reduced at 25 degrees. egl-1(cdb97) contains engineered mutations in mir-35 binding site in the 3’UTR region making the sequence complementary to the mir-35(cdb4) variant. Reference: Yang B, et al. Genes Dev. 2020 Sep 1;34(17-18):1227-1238. PMID: 32820039

Superficially wild type. Seed mutation of mir-35 was made by two rounds of CRISPR/Cas9 editing. cdb2 is a 50 bp deletion of the mir-35 locus. cdb4 was created by successive homology-directed repair of the disrupted mir-35 locus with a protospacer to preserve the secondary structure of the primary and precursor hairpin. egl-1(cdb97) contains engineered mutations in mir-35 binding site in the 3’UTR region making the sequence complementary to the mir-35(cdb4) variant. Reference: Yang B, et al. Genes Dev. 2020 Sep 1;34(17-18):1227-1238. PMID: 32820039

nhl-2(cdb100) contains engineered mutations in the mir-35 binding site in the nhl-2 3’UTR region making the sequence complementary to the mir-35(cdb4) variant. egl-1(cdb97) contains engineered mutations in mir-35 binding site in the egl-1 3’UTR region making the sequence complementary to the mir-35(cdb4) variant. Slightly reduced brood size at 25C. Reference: Donnelly BF, et al. (2022). Cell Reports.

Superficially wild-type. egl-1(cdb97) contains engineered mutations in mir-35 binding site in the 3’UTR region making the sequence complementary to the mir-35(cdb4) variant. Reference: Yang B, et al. Genes Dev. 2020 Sep 1;34(17-18):1227-1238. PMID: 32820039

Slow generation time, 6-7 days. Progeny production and survival to reproduction are reduced.

WT. lb88 is a recessive X-linked suppressor of unc-8 dominant mutations.

mCherry knocked into C terminal of vit-6 by CRISPR/Cas9 in the background of parental strain BCN9071 vit-2(crg9070[vit-2::gfp]) X. This resulting double-labelled strain was crossed six times with N2 to remove potential off-target mutations. mCherry and GFP are co-localized in the intestine, body cavity, oocyte, and embryo in adult hermaphrodites. Reference: Zhai C, et al. Aging cell, 21(11), e13719. https://doi.org/10.1111/acel.13719 PMID: 36199214.

mCherry knocked into C terminal of vit-3 by CRISPR/Cas9 in the background of parental strain BCN9071 vit-2(crg9070[vit-2::gfp]) X. This resulting double-labelled strain was crossed six times with N2 to remove potential off-target mutations. mCherry and GFP are co-localized in the intestine, body cavity, oocyte, and embryo in adult hermaphrodites. Reference: Zhai C, et al. Aging cell, 21(11), e13719. https://doi.org/10.1111/acel.13719 PMID: 36199214.

mCherry knocked into C terminal of vit-1 by CRISPR/Cas9 in the background of parental strain BCN9071 vit-2(crg9070[vit-2::gfp]) X. This resulting double-labelled strain was crossed six times with N2 to remove potential off-target mutations. mCherry and GFP are co-localized in the intestine, body cavity, oocyte, and embryo in adult hermaphrodites. Reference: Zhai C, et al. Aging cell, 21(11), e13719. https://doi.org/10.1111/acel.13719 PMID: 36199214.

Double mutant is less sensitive to ionizing radiation than the parg-2(ok980) single mutant, but as sensitive as the exo-1(tm1842) single mutant. Parental parg-2(ok980) strain outcrossed 6 times; parental exo-1(tm1842) strain outcrossed 4 times. Reference: Bae W, et al. Hypersensitivity to DNA double-strand breaks associated with PARG deficiency is suppressed by exo-1 and polq-1 mutations in Caenorhabditis elegans. The FEBS Journal, In press.

Hypersensitivity to ionizing radiation due to the parg-2(ok980) mutation is rescued by the polq-1(tm2572) mutation.  The double mutant is as sensitive as the wild-type to ionizing radiation. Parental parg-2(ok980) strain outcrossed 6 times; parental polq-1(tm2572) strain outcrossed 5 times. Reference: Bae W, et al. Hypersensitivity to DNA double-strand breaks associated with PARG deficiency is suppressed by exo-1 and polq-1 mutations in Caenorhabditis elegans. The FEBS Journal, In press.