Strain Information
| Name | GLW2 View On Wormbase |
|---|---|
| Species | C. elegans |
| Genotype | attf-2(utx2[mNG::attf-2]) V. |
| Description | Superficially wild-type. N-terminal tag of ATTF-2 via CRISPR/Cas9 knock-in of mNeonGreen at attf-2 locus. Insertion verified by PCR. Left flank: 5' cttttttgctcacatcatcatttttcagtc 3'; Right flank: 5' ATGTCGGCCGAGACCGCGACTATCCCCGAAGTTTC 3' (5 silent mutations). sgRNA: 5' CGAAACTGCAACCATACCCG 3' |
| Mutagen | CRISPR/Cas9 homologous recombination |
| Outcrossed | x0 |
| Made by | George Huang (Glow Worms '20) |
| Laboratory | GLW |
| Reference | N/A |
Sign in
or
register an account if you want to order this strain.