| CB187 |
C. elegans |
rol-6(e187) II. Show Description
Right hand Roller. Recessive. M-MATING-NO SUCCESS. |
|
| HE1006 |
C. elegans |
rol-6(su1006) II. Show Description
Dominant Roller. |
|
| JW29 |
C. elegans |
jeIs1I. Show Description
jeIs1 [mec-7(+)::lacZ + rol-6(su1006)]. Rollers. Males will mate. |
|
| MT2709 |
C. elegans |
rol-6(e187n1270) II. Show Description
Revertant. Phenotypically WT. |
|
| OH2724 |
C. elegans |
otIs133; otEx1545. Show Description
otIs133 [pttx-3::RFP + unc-4(+)]. otEx1545 [F11H8.2::GFP + rol-6(su1006)]. Maintain by picking GFP+ Rollers. RFP expressed in AIY only. Reference: Wenick AS, Hobert O. Wenick AS, Hobert O. Developmental Cell. 2004 Jun;6(6):757-70. |
|
| OH7317 |
C. elegans |
F21H12.1(ot86) rol-6(e187) II; ntIs1 V. Show Description
ntIs1 [gcy-5p::GFP + lin-15(+)] V. Ectopic expression of ntIs1 in ASEL. Rollers. Whole genome sequenced strain. |
|
| WM79 |
C. elegans |
rol-6(n1270) II; neEx1. Show Description
Rollers. n1270 is phenotypically wild type. neEx1[LIT-1::GFP + rol-6(su1006)]. LIT-1::GFP has full length LIT-1 fused to GFP in a YAC. Pick Rollers to maintain. |
|
| CL802 |
C. elegans |
smg-1(cc546) I; rol-6(su1006) II. Show Description
Rollers. Maintain under normal conditions. Standard control for CL4176; originally used CL1175 as the control, but subsequently it was found that CL1175 can produce some A-Beta. Reference: Fonte V., et al. Mol Neurodegener. 2011 Aug 23;6(1):61. [NOTE: The temperature-sensitive allele cc546 causes an M1957L change in SMG-1. The lesion is an atg>ttg transversion in exon 35. Flanking sequences follow with the mutation site indicated with a capital A: ttggtggtcggttacaaaacgatattcaaga tcactggcagtcatgagtAtggttggatcagttttaggactcggtgatcg acatttggacaatttattg The lesion is detectable via SNP-snip with the mutation causing loss of an MslI site. Primers are for a 323 bp product. Digest with MslI to 86+237 in the wild type, uncut as 323 in the mutant. DJR701(f): CAGTCGTGAGCTTTGGATGCGTGC DJR702(r): TCGGGGATACGCAGATTCTTTCCC. Pedone ... Reiner G3 (2021).] |
|
| DR518 |
C. elegans |
rol-6(su1006) unc-4(e120) II. Show Description
RollerUnc. |
|
| EW23 |
C. elegans |
unc-104(e1265) rol-6(e187) II. Show Description
Dpy. Roller. |
|
| GE1710 |
C. elegans |
rol-6(e187) unc-4(e120) II. Show Description
Roller Unc. |
|
| JK3091 |
C. elegans |
ehn-1(q690) rol-6(e187) II. Show Description
Rollers. About 15% have a one-armed gonad or are WP. Do not distribute this strain; other labs should request it from the CGC. |
|
| CF12 |
C. elegans |
rol-6(e187) II; lin-22(n372) IV; him-5(e1490) V. Show Description
Rollers. lin-22 and him-5 mutations affect neuroblast formation from epidermal precursor cell V5. |
|
| CX3940 |
C. elegans |
kyIs140 I; rol-6(e187) II; slo-1(ky399) V. Show Description
kyIs140 [str-2::GFP + lin-15(+)] I. In ky399 mutants str-2::GFP is expressed in both AWX neurons. ky399 is a semi-dominant allele of slo-1, a large conductance potassium channel. PKA nsy-3(ky399). Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects. |
|
| EG1000 |
C. elegans |
dpy-5(e61) I; rol-6(e187) II; lon-1(e1820) III. Show Description
Dpy suppresses Rol and Lon. Strain appears to be only Dpy. Useful for mapping, especially Unc mutations. Separately, dpy-5 causes extreme dumpiness, rol-6 causes worms to roll over and lie in a "C" shape, and lon-1 worms are about 125% WT length. |
|
| GE1712 |
C. elegans |
vab-9(e1744) rol-6(e187) unc-4(e120) II. Show Description
Unc. Roller. Tail whip knobbed at all stages except adult male (adult male tail tip slightly swollen). |
|
| MT3751 |
C. elegans |
dpy-5(e61) I; rol-6(e187) II; unc-32(e189) III. Show Description
|
|
| GD211 |
C. elegans |
rol-6(e187) hlh-6(tm299) unc-4(e120) II. Show Description
|
|
| MDH10 |
C. elegans |
ast-1(hd1) rol-6(e187) II; ceh-43(ot406) III; vtIs1 V. Show Description
vtIs1 [dat-1p::GFP + rol-6(su1006)] V. Rollers. ot406 has a dopaminergic phenotype. |
|
| ML503 |
C. elegans |
tra-2(q276)/rol-6(e187) II; mcDf2/dpy-8(e130) X. Show Description
Segregates WT, males, Dpy, Rol, DpyRol, dead eggs (mcDf2). Use XX tra-2 males to move mcDf2 around. mcDf2 is an approx. 500 kb deficiency removing a large chunk between mec-2 and sup-7 (non-inclusive). |
|
| JJ1550 |
C. elegans |
dpl-1(zu355) unc-4(e120)/rol-6(e187) let-23(sy97) II. Show Description
Heterozygotes are WT and segregate WT, Uncs which give only deads egss with a Mex phenotype, and Vulvaless Rollers. sy97 is only 15% viable. |
|
| MDH91 |
C. elegans |
ast-1(hd1) rol-6(e187) II; ceh-20(ok541) III; vtIs1 V; ceh-40(gk159) X; muEx261. Show Description
vtIs1 [dat-1p::GFP + rol-6(su1006)] V. muEx261 [ceh-20::GFP + odr-1::RFP]. Pick RFP+ animals to maintain. Rollers. Embryonic lethality of ceh-20(ok541); ceh-40(gk159) double mutants is rescued by muEx261. |
|
| AG226 |
C. elegans |
rol-6(e187) unc-4 (e120)/mnC1 [dpy-10(e128) unc-52(e444) nIs190 let-?] II; him-8(e1489) IV. Show Description
nIs190 [myo-2::GFP]. Him. Heterozygotes are wild-type GFP+ and segregate WT GFP+ heterozygotes, Rol Uncs, dead embryos, and males. nIs190 [myo-2::GFP] integrated in or near mnC1. Approx 0.5% recombination seen between nIs190 and mnC1. Fails to complemement all markers on mnC1. |
|
| DA438 |
C. elegans |
bli-4(e937) I; rol-6(e187) II; daf-2(e1368) vab-7(e1562) III; unc-31(e928) IV; dpy-11(e224) V; lon-2(e678) X. Show Description
Linkage mapping strain. Maintain at 15C. |
|
| AGD1047 |
C. elegans |
glp-1(e2141) III; uthEx649. Show Description
uthEx649 [rpn-6p::tdTomato + rol-6(su1006)]. Temperature-sensitive. Maintain at 15C; sterile at 25C. Rollers. Pick rollers to maintain array. Reference: Vilchez D, et al. Nature. 2012 Sep 13;489(7415):263-8. |
|
| AGD1048 |
C. elegans |
daf-16(mu86) I; glp-1(e2141) III; uthEx649. Show Description
uthEx649 [rpn-6p::tdTomato + rol-6(su1006)]. Temperature-sensitive. Maintain at 15C; sterile at 25C. Rollers. Pick rollers to maintain array. Reference: Vilchez D, et al. Nature. 2012 Sep 13;489(7415):263-8. |
|
| AGD383 |
C. elegans |
uthIs202. Show Description
uthIs202 [aak-2(intron 1)::aak-2(aa1-aa321)::Tomato::unc-54 3'UTR + rol-6(su1006)]. Pick Rollers to maintain. Reference: Mair W, et al. Nature. 2011 Feb 17;470(7334):404-8. |
|
| AGD397 |
C. elegans |
aak-1(tm1944) III; aak-2(ok524) X; uthEx202. Show Description
uthEx202 [crtc-1p::crtc-1 cDNA::tdTomato::unc-54 3'UTR + rol-6(su1006)]. Pick Rollers to maintain. Reference: Mair W, et al. Nature. 2011 Feb 17;470(7334):404-8. |
|
| AGD418 |
C. elegans |
uthIs205. Show Description
uthIs205 [crtc-1p::crtc-1::RFP::unc-54 3'UTR + rol-6(su1006)]. |
|
| AGD448 |
C. elegans |
uthEx488. Show Description
uthEx488 [crtc-1p::crtc-1 cDNA (S179A)::tdTomato + rol-6(su1006)]. Pick Rollers to maintain. Reference: Mair W, et al. Nature. 2011 Feb 17;470(7334):404-8. |
|
| AGD466 |
C. elegans |
uthEx222. Show Description
uthEx222 [crtc-1p::crtc-1 cDNA (S76A, S179A)::tdTomato::unc-54 3'UTR + rol-6(su1006)]. Pick Rollers to maintain. Reference: Mair W, et al. Nature. 2011 Feb 17;470(7334):404-8. |
|
| AGD467 |
C. elegans |
uthEx490. Show Description
uthEx490 [aak-2 (intron 1)::aak-2(aa1-aa321 T172D)::GFP + crtc-1p::crtc-1::tdTomato + rol-6(su1006)]. Pick Rollers to maintain. Reference: Mair W, et al. Nature. 2011 Feb 17;470(7334):404-8. |
|
| AGD469 |
C. elegans |
uthEx492. Show Description
uthEx492 [aak-2 (intron 1)::aak-2(aa1-aa321 T172A)::GFP + crtc-1p::crtc-1::tdTomato + rol-6(su1006)]. Pick Rollers to maintain. Reference: Mair W, et al. Nature. 2011 Feb 17;470(7334):404-8. |
|
| AGD470 |
C. elegans |
uthEx493. Show Description
uthEx493 [crtc-1p::crtc-1 cDNA (S76A)::tdTomato + rol-6(su1006)]. Pick Rollers to maintain. Reference: Mair W, et al. Nature. 2011 Feb 17;470(7334):404-8. |
|
| AGD945 |
C. elegans |
uthEx649. Show Description
uthEx649 [rpn-6p::tdTomato + rol-6(su1006)]. Rollers. Pick rollers to maintain array. Reference: Vilchez D, et al. Nature. 2012 Sep 13;489(7415):263-8. |
|
| AGD946 |
C. elegans |
uthEx650. Show Description
uthEx650 [rpn-6p::tdTomato + rol-6(su1006)]. Rollers. Pick rollers to maintain array. Reference: Vilchez D, et al. Nature. 2012 Sep 13;489(7415):263-8. |
|
| AGK369 |
C. elegans |
zfp-1(ok554) III; armIs8. Show Description
armIs8 [zfp-1(short isoform)::FLAG::GFP + rol-6(su1006)]. Rollers. The fosmid-based armIs8 transgene rescues the protruded vulva phenotype of zfp-1(ok554). Ubiquitous nuclear localization of zfp-1(long isoform)::FLAG::GFP is observed in somatic cells in all developmental stages, but is silenced in the germline. See AGK26 for germline-expressing zfp-1::GFP. Reference: Avgousti DC, et al. Mol Cell Biol. 2013 Mar;33(5):999-1015. |
|
| AGK370 |
C. elegans |
zfp-1(ok554) III; armIs9. Show Description
armIs9 [zfp-1(long isoform)::FLAG::GFP + rol-6(su1006)]. Rollers. The fosmid-based armIs9 transgene rescues zfp-1(ok554)/nDf17 lethality. Ubiquitous nuclear localization of zfp-1(long isoform)::FLAG::GFP is observed in somatic cells in all developmental stages, but is silenced in the germline. See AGK26 for germline-expressing zfp-1::GFP. Reference: Avgousti DC, et al. Mol Cell Biol. 2013 Mar;33(5):999-1015. |
|
| AGK573 |
C. elegans |
otIs225 II; daf-18(ok480) IV; armEx218. Show Description
otIs225 [cat-4::GFP] II. armEx218 [unc-119p::daf-18 + unc-119p::tagRFP + rol-6(su1006)]. Pick Rollers to maintain. Transgenic array expresses DAF-18 from unc-119 pan-neuronal promoter; rescues the HSN under-migration phenotype in daf-18 null mutants. Reference: Kennedy LM, et al. Cell Rep. 2013 Sep 12;4(5):996-1009. |
|
| AGK587 |
C. elegans |
armEx227. Show Description
armEx227 [pak-1p::NLS::tagRFP + rol-6(su1006)]. Pick rollers to maintain. pak-1p::NLS::tagRFP is expressed primarily in the hypodermal tissue during the comma and 1.5-fold stages, and in the CAN cells at the 3-fold stage through adulthood. Expression can also be seen in additional neurons during the larval and adult stages. Reference: Kennedy LM, et al. Cell Rep. 2013 Sep 12;4(5):996-1009. |
|
| AMH43 |
C. elegans |
unc-33(e204) IV; adIs2122. Show Description
adIs2122 [lgg-1p::GFP::lgg-1 + rol-6(su1006)]. Rollers. Unc. |
|
| ANR153 |
C. elegans |
rde-1(ne300) V.; neIs9 X; pkIs2386. Show Description
pkIs2386 [unc-54p::alphasynuclein::YFP + unc-119(+)]. neIs9 [myo-3::HA::rde-1 + rol-6(su1006)] X. Rollers. YFP expression in the muscles. Derived by crossing parental strains NL5901 and WM118 to produce a Parkinson's model with muscle-only RNAi. Reference: Snow S, et al. (2024). Neuronal CBP-1 is required for enhanced body muscle proteostasis in response to reduced translation downstream of mTOR. Frontiers in Bioscience-Landmark. |
|
| AV221 |
C. elegans |
unc-119(ed3) meT8 (III); meIs4 meT8 (IV); meIs1. Show Description
meIs1 [pie-1p::GFP::lacI + unc-119(+)]. meIs4 [lac-O + rol-6(su1006) + lacO] IV. Pick Rol worms to maintain. This strain throws both Rol and non-Rol worms, seemingly due to random silencing of rol-6(su1006) in the lacO array, meIs4. The strain expresses GFP::LacI in the gonad and embryos that is observed as foci (of lacO target) and nuclear haze. The expression level of GFP::LacI occasionally becomes low possibly due to random silencing of meIs1. If this happens, heat shock the strain at 25°C for 3 days, and pick a clone that exhibits bright GFP signals. Even at the highest expression level, GFP signal is too weak to detect with a fluorescent dissection microscope, and it is necessary to use a regular compound fluorescent microscope with an oil immersion 60X or 100X objective. The NA of the objective should be higher than 1.4. Reference: Bilgir C, et al. G3 (Bethesda). 2013 Mar 11. pii: g3.112.005165v1. |
|
| AVS310 |
C. elegans |
artEx27. Show Description
artEx27 [hpk-1p::hpk-1::GFP + rol-6(su1006)]. Full-length C-terminal hpk-1::GFP fusion. Broad pattern of developmental GFP expression in the intestine, hypodermal seam cells, and neurons. Reference: Das R, et al. PLoS Genet. 2017 Oct 16;13(10):e1007038. doi: 10.1371/journal.pgen.1007038. PMID: 29036198; PMCID: PMC5658188. |
|
| AVS394 |
C. elegans |
artEx12. Show Description
artEx12 [hpk-1p::GFP + rol-6(su1006)]. Pick Rollers to maintain. Transcriptional fusion of hpk-1 promoter with GFP. Reference: Das R, et al. PLoS Genet. 2017 Oct 16;13(10):e1007038. doi: 10.1371/journal.pgen.1007038. PMID: 29036198; PMCID: PMC5658188. |
|
| AVS411 |
C elegans |
artEx30. Show Description
artEx30 [hpk-1p::hpk-1::tdTomato + hsf-1p::hsf-1::GFP + rol-6 (su1006)]. Pick Rollers to maintain. Reference: Das R, PLoS Genet. 2017 Oct 16;13(10):e1007038. doi: 10.1371/journal.pgen.1007038. PMID: 29036198; PMCID: PMC5658188. |
|
| AVS413 |
C. elegans |
hpk-1(pk1393) X; artEx29. Show Description
artEx29 [hpk-1p::hpk-1::GFP + rol-6(su1006)]. Full-length C-terminal hpk-1::GFP fusion transgene rescues the progeric phenotype of hpk-1(pk1393). Reference: Das R, et al. PLoS Genet. 2017 Oct 16;13(10):e1007038. doi: 10.1371/journal.pgen.1007038. PMID: 29036198; PMCID: PMC5658188. |
|
| AY101 |
C. elegans |
acIs101. Show Description
acIs101 [F35E12.5p::GFP + rol-6(su1006)]. Rollers. Reference: (2010) J Bio Chem 285(14):10832-40. |
|
| AY102 |
C. elegans |
pmk-1(km25) IV; acEx102. Show Description
acEx102 [vha-6p::pmk-1::GFP + rol-6(su1006)]. Maintain by picking Rollers. Reference: (2010) J Bio Chem 285(14):10832-40. |
|
| AY187 |
C elegans |
nhr-8(ok186) IV; acEx187. Show Description
acEx187 [vha-6p::nhr-8::SL2::GFP + rol-6(su1006)]. Pick Rollers to maintain (GFP expression in intestine is easy to see and might be easier to score than Rol). Intestinal rescue of nhr-8(ok186) mutants. Reference: Otarigho B & Aballay A. 2020. iScience. 2020 May 22;23(5):101068. doi: 10.1016/j.isci.2020.101068. PMID: 32361270. |
|