Strain Information
| Name | HBR2317 View On Wormbase |
|---|---|
| Species | C. elegans |
| Genotype | nlp-8(syb762) IV. |
| Description | syb762 is a 1076 bp deletion in nlp-8. Flanking sequences: taaaacccggaacc - acttcttgaacaactg Forward primer: TAAAAGCGGAGTAGCGTCCA Reverse primer: CAGATGGTCGGGTGATTTGA syb762 was generated in a mutant background and out-crossed to N2 to remove those background mutations. Reference: Sinner MP, et al. Curr Biol. 2021 Feb 8;31(3):564-577.e12. PMID: 33259791 |
| Mutagen | Crispr/Cas9 |
| Outcrossed | x1 |
| Made by | Marina Sinner /SunyBiotech |
| Laboratory | HBR |
| Reference | https://doi.org/10.1016/j.cub.2020.10.076 |
Sign in
or
register an account if you want to order this strain.