Search Strains

More Fields
Strain Species Genotype Add
OD2174 C. elegans unc-119(ed3) III; mdf-2(lt4::loxP::Cbr-unc-119(+)::loxP) IV/nT1 [qIs51] (IV;V). Show Description
CRISPR/Cas9 engineered deletion of mdf-2 in which the mdf-2 coding sequence was replaced by unc-119. Heterozygotes are wild-type GFP+ and segregate mdf-2 null homozygotes (low brood size/embryonic lethal), wild-type GFP+ heterozygotes, and arrested nT1[qIs51] aneuploids. Pick wild-type GFP+ and check for correct segregation of progeny to maintain. Unknown if unc-119(ed3) from parental strain is still carried in the background. gRNA sequence: Gccaaattccccagttttag Reference: Lara-Gonzalez P, et al. Dev Cell. 2019 Nov 4;51(3):313-325.e10. doi: 10.1016/j.devcel.2019.09.005. PMID: 31588029.
OD2359 C. elegans fzy-1(lt20::loxP)/mIn1[mIs14 dpy-10(e128)] II. Show Description
CRISPR/Cas9 engineered deletion of fzy-1 in which the fzy-1 coding sequence was replaced by LoxP. Homozygous lethal deletion chromosome balanced by GFP- and dpy-10-marked inversion. Heterozygotes are wild-type with relatively dim pharyngeal GFP signal, and segregate wild-type dim GFP (heterozygotes), Dpy bright GFP (mIn1 homozygotes), and non-GFP fzy-1 homozygotes (larval arrest). Pick wild-type with dim GFP and check for correct segregation of progeny to maintain. gRNA sequence: Ggacgcacgcccggtagtgc Reference: Kim T, et al. Genes Dev. 2017 Jun 1;31(11):1089-1094. doi: 10.1101/gad.302067.117. PMID: 28698300.
OD2773 C. elegans ltSi915 II; unc-119(ed3) III. Show Description
ltSi915 [osm-6p::zif-1::operon-linker::mCherry::histone::tbb-2 3'UTR + Cbr-unc-119(+)] II. This strain provides a sensory neuron-specific source of ZIF-1 alone and serves as a control strain for OD2772, which mediates ciliated sensory neuron-specific degradation of GFP-tagged proteins. It can also be used as source of sensory-specific ZIF-1 for other applications. Superficially wild type. Reference: Wang S, et al. Development. 2017 Jun 15. pii: dev.150094. doi: 10.1242/dev.150094.
OD3737 C. elegans cyb-3(lt110) V/nT1 [qIs51] (IV;V). Show Description
CRISPR/Cas9 engineered deletion of cyb-3. Heterozygotes are wild-type GFP+ and segregate mdf-2 null homozygotes (embryonic lethal), wild-type GFP+ heterozygotes, and arrested nT1[qIs51] aneuploids. Pick wild-type GFP+ and check for correct segregation of progeny to maintain. gRNA sequences: tcaggtcgacattcttggcc & gttatgggtatgagagcatt Reference: Lara-Gonzalez P, et al. Dev Cell. 2019 Nov 4;51(3):313-325.e10. doi: 10.1016/j.devcel.2019.09.005. PMID: 31588029.
OD95 C. elegans unc-119(ed3) III; ltIs37 IV; ltIs38. Show Description
ltIs37 [pie-1p::mCherry::his-58 + unc-119(+)] IV. ltIs38 [pie-1p::GFP::PH(PLC1delta1) + unc-119(+)]. Superficially wild-type. Maintain under normal conditions. Reference: Essex A, et al. Mol Biol Cell. 2009 Feb;20(4):1252-67. doi: 10.1091/mbc.e08-10-1047. Epub 2008 Dec 24. PMID: 19109417
OG1124 C.elegans ogt-1(dr84[ogt-1::GFP]) III. Show Description
Endogenous ogt-1 locus tagged with C-terminal GFP. OGT-1::GFP is expressed ubiquitously in somatic tissues with a nuclear localization. The OGT::GFP allele is functional. Superficially wild-type. Sanger sequence confirmed. Reference: Urso SJ, et al. (2020). The O-GlcNAc transferase OGT is a conserved and essential regulator of the cellular and organismal response to hypertonic stress. bioRxiv, 2020.2005.2001.072033.
OG472 C. elegans drSi2 II; unc-119(ed3) III. Show Description
drSi2 [vha-6p::3XFLAG::pgp-3/CFTR(wt)::mCherry::unc-54 3'UTR] II. Superficially wild-type with mCherry expression only in the intestine with enrichment at the apical membrane. Single copy integration of the vha-6 promoter driving the PGP-3 protein with an N-terminal 3XFLAG tag and a C-terminal mCherry tag. Amino acids 476-484 of PGP-3 have been replaced with amino acids 501-509 of human CFTR (TIKENIIFG). Transgene was inserted at the ttTi5605 locus on LGII and verified to be a single copy insertion by long range PCR across the genomic locus. Reference: He L, et al. Dis Model Mech. 2012 Nov;5(6):930-9.
OG474 C. elegans drSi4 II; unc-119(ed3) III. Show Description
drSi4 [vha-6p::3XFLAG::pgp-3/CFTR(delta F508)::mCherry::unc-54 3'UTR] II. Superficially wild-type with mCherry expression only in the intestine with significantly diminished expression as compared to drSi2. Single copy integration of the vha-6 promoter driving the PGP-3 protein with an N-terminal 3XFLAG tag and a C-terminal mCherry tag. Amino acids 476-484 of PGP-3 have been replaced with amino acids 501-509 of human CFTR with F508 deleted (TIKENII_G). Transgene was inserted at the ttTi5605 locus on LGII and verified to be a single copy insertion by long range PCR across the genomic locus. Reference: He L, et al. Dis Model Mech. 2012 Nov;5(6):930-9.
OG566 C. elegans drSi28 II; unc-119(ed3) III. Show Description
drSi28 [hsf-1p::hsf-1(R145A)::GFP::unc-54 3'UTR + Cbr-unc-119(+)] II. hsf-1 cDNA containing an arginine to alanine mutation at residue 145 in the DNA binding domain, with a C-terminal GFP and under control of 4 kb of the hsf-1 promoter, integrated at a single copy by MosSCI on chromosome II at ttTi5605 in EG4322. Exhibits nuclear GFP expression that redistributes into granules at a reduced rate compared to wild type immediately after 1 min 35C heat shock. Reference: Morton EA, Lamitina T. Aging Cell. 2012 Oct 26. doi: 10.1111/acel.12024.
OG575 C. elegans hsf-1(ok600) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III); drSi13 II. Show Description
drSi13 [hsf-1p::hsf-1::GFP::unc-54 3'UTR + Cbr-unc-119(+)] II. Expresses single-copy drSi13 in the background of balanced hsf-1(ok600). drSi13 includes hsf-1 cDNA with a C-terminal GFP and controlled by 4 kb of the hsf-1 promoter, integrated at a single copy by MosSCI on chromosome II at ttTi5605. Segregates WT GFP+ heterozygotes, non-GFP rescued ok600; drSi13 homozygotes, very rare GFP+ homozygous hT2, and dead eggs. Maintain by picking wild-type GFP+. Reference: Morton EA, Lamitina T. Aging Cell. 2012 Oct 26. doi: 10.1111/acel.12024.
OG576 C. elegans hsf-1(ok600) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
Segregates WT GFP+ heterozygotes, larval-arrested ok600 homozygotes, very rare GFP+ homozygous hT2, and dead eggs. Maintain by picking wild-type GFP+. [NOTE: Although ok600 has been reported as a 1085 bp deletion in hsf-1, sequencing of the hsf-1 PCR product revealed only an 877 bp deletion (5'-AAATAAAAATTTCTTAGAAA [877 bp deletion] TGTACATGGGATCCGGTCCA-3'). (Lamitina Lab, 12/17/2012)]
OG584 C. elegans hsf-1(ok600) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III); drSi28 II. Show Description
drSi28 [hsf-1p::hsf-1(R145A)::GFP::unc-54 3'UTR + Cbr-unc-119(+)] II. Expresses single-copy drSi28 in the background of balanced hsf-1(ok600). drSi28 includes hsf-1 cDNA containing an arginine to alanine mutation at residue 145 in the DNA binding domain with a C-terminal GFP and controlled by 4 kb of the hsf-1 promoter, integrated at a single copy by MosSCI on chromosome II at ttTi5605. Segregates WT GFP+ heterozygotes, non-GFP ok600 homozygotes (not rescued by drSi28), very rare GFP+ homozygous hT2, and dead eggs. Maintain by picking wild-type GFP+. Reference: Morton EA, Lamitina T. Aging Cell. 2012 Oct 26. doi: 10.1111/acel.12024.
OH11705 C. elegans ham-3(n1654) III; otEx5093. Show Description
otEx5093 [ham-3p::ham-3::GFP + elt-2::DsRed]. Strain can be maintained at 25C to increase frequency of array transmission. Pick GFP+ or DsRed+ to maintain. DsRed expression is difficult to detect at low magnification. otEx5093 rescues n1654; animals carrying the array are essentially wild-type. n1654 homozygotes without the array are Egl, slow growing, and lethal/sterile at 25C.
OH14420 C. elegans pals-22(ot811) III; otIs381 V; otEx6761. Show Description
otIs381 [ric-19p(prom6)::2xNLS::GFP + elt-2::DsRed] V. Pan-neuronal nuclear GFP expression. otEx6761 [pals-22(+) + ttx-3p::mChOPTI]; derived from PCR fragment containing the genomic pals-22 locus. pals-22(ot811) mutant shows transgene-silencing phenotype; otEx6761 rescues ot811 and restores otIs381 expression at wild-type levels. Reference: Stefanakis N., Carrera I., Hobert O. Neuron. 2015 Aug 19;87(4):733-50. Leyva-Díaz E, et al. Genetics (2017), 207(2):529-545.
OH14429 C. elegans pals-22(ot811) III; otIs381 V; otEx6769. Show Description
otIs381 [ric-19p(prom6)::2xNLS::GFP + elt-2::DsRed] V. Pan-neuronal nuclear GFP expression. otEx6769 [pals-22(fosmid) + myo-2p::mChOPTI]; derived from NotI digestion of WRM0616DC09. pals-22(ot811) mutant shows transgene-silencing phenotype; otEx6769 rescues ot811 and restores otIs381 expression at wild-type levels. Reference: Stefanakis N., Carrera I., Hobert O. Neuron. 2015 Aug 19;87(4):733-50. Leyva-Díaz E, et al. Genetics (2017), 207(2):529-545.
OH15568 C. elegans unc-17(ot907[unc-17::mKate2::3xflag]) IV. Show Description
Superficially wild-type. mKate2 and 3xFlag tag added to endogenous unc-17 locus. unc-17::mKate2 labels all cholinergic neurons in the nervous system. Reference: Pereira L, et al. Elife. 2019 Jan 1;8. pii: e42078. doi: 10.7554/eLife.42078.
OH15910 C. elegans lin-11(ot958[lin-11::GFP::FLAG]) I. Show Description
Superficially wild-type. Insertion of GFP and FLAG tags directly before the stop codon of endogenous lin-11 locus. Verified by sequencing. Reference: Reilly MB, et al. Nature. 2020 Aug;584(7822):595-601. PMID: 32814896.
OH15912 C. elegans vab-7(ot959[vab-7::GFP::FLAG]) III. Show Description
Superficially wild-type. Insertion of GFP and FLAG tags directly before the stop codon of endogenous vab-7 locus. Verified by sequencing. Reference: Reilly MB, et al. Nature. 2020 Aug;584(7822):595-601. PMID: 32814896.
OH16020 C. elegans exc-7(ot970[exc-7::gfp]) II. Show Description
Superficially wild-type. GFP inserted into endogenous exc-7 locus by CRISPR/Cas9. Reference: Pham K & Hobert O. MicroPubl Biol. 2019; 2019: 10.17912/micropub.biology.000189.
OH16294 C. elegans nono-1(ot1018[nono-1::gfp::3xflag]) III. Show Description
Superficially wild-type.
OH16345 C. elegans ceh-37(ot1023[ceh-37::GFP::FLAG]) X. Show Description
Superficially wild-type. Insertion of GFP and FLAG tags directly before the stop codon of endogenous ceh-37 locus. Verified by sequencing. Reference: Reilly MB, et al. Nature. 2020 Aug;584(7822):595-601. PMID: 32814896.
OH16461 C. elegans ama-1(ot1037[gfp::ama-1]) IV. Show Description
Superficially wild-type.
OH16463 C. elegans smo-1(ot1038[smo-1::gfp::3xflag]) I. Show Description
Superficially wild-type.
OH16464 C. elegans fust-1(ot1039[fust-1::gfp::3xflag]) II. Show Description
Superficially wild-type.
OH16482 C. elegans rpc-1(ot1041[rpc-1::gfp::3xflag]) IV. Show Description
Superficially wild-type.
OH16487 C. elegans ceh-76(ot1042[ceh-76::GFP]) V. Show Description
Superficially wild-type. Insertion of GFP and FLAG tags directly before the stop codon of endogenous ceh-76 locus. Verified by sequencing. Reference: Reilly MB, et al. Nature. 2020 Aug;584(7822):595-601. PMID: 32814896.
OH16505 C. elegans ceh-89(ot1050[ceh-89::GFP]) X. Show Description
Superficially wild-type. Insertion of GFP and FLAG tags directly before the stop codon of endogenous ceh-89 locus. Verified by sequencing. Reference: Reilly MB, et al. Nature. 2020 Aug;584(7822):595-601. PMID: 32814896.
OH16704 C. elegans fox-1(ot1081[fox-1::gfp::3xflag]) X. Show Description
Superficially wild-type.
OH910 C. elegans otIs77 II. Show Description
otIs77 [ttx-3p::kal-1 + unc-122p::GFP] II. Overexpressing line from P. Loria. The integrated array has been mapped to LG II between stP36 and maP1. AIY interneurons have a 100% penetrant axon branching phenotype. Otherwise, the animals look phenotypically wild type.
OH911 C. elegans him-5(e1490) V; otIs35 X. Show Description
otIs35 [ttx-3p::kal-1 + rol-6(su1006)] X. otIs35 has been mapped to LG X between lon-2 and hst-6. Superficially wild-type; AIY interneurons have a 100% penetrant axon branching phenotype.
OH912 C. elegans otIs76 mgIs18 IV. Show Description
otIs76 [pttx-3p::kal-1 + unc-122p::GFP] IV. mgIs18 [ttx-3p::GFP] IV. otIs76 is closely linked to mgIs18 on LG IV. Superficially wild-type. AIY interneurons have a 100% penetrant axon branching phenotype.
OK461 C. elegans bcl-11(cu10)/unc-46(e177) dpy-11(e224) V. Show Description
Pick wild-type to maintain. Heterozygotes are wild-type and should segregate wild-type heterozygotes, bcl-11 homozygotes (L1 larval arrest with starved appearance), and Dpy Unc homozygotes (Medium Dpy, Shrinker, poor backing). Maintain by picking wild-type and scoring for proper segregation of progeny. bcl-11 homozygotes have weak pharyngeal muscle contractions and pharyngeal lumen fails to open. cu10 is a 555 bp deletion (V:6360921..6361460). Predicted bcl-11 null allele. Reference: Vilimas, Tomas. (2004). Genes regulating ceh-22 and pharyngeal development of Caenorhabditis elegans.. University of Illinois at Chicago. Thesis. https://hdl.handle.net/10027/12060
OK814 C. elegans nfyb-1(cu13) II. Show Description
Superficially wild-type. Reference: Milton AC, et al. Dev Biol. 2013 Oct 1;382(1):38-47.
OP212 C. elegans unc-119(ed3) III; ddEx58. Show Description
ddEx58 [F45C12.2::TY1::EGFP::3xFLAG(92C12) + unc-119(+)]. Pick wild-type to maintain array. TY1::EGFP::3xFLAG tag inserted in frame at C-terminus of coding sequence by recombineering. Expression of transgene confirmed by GFP. References: Sarov, M, et al. Cell. 2012 Aug 17;150(4):855-66. Strain was constructed as part of the Regulatory Element Project, part of modENCODE (http://www.modencode.org)
OT136 C. elegans mua-3(rh195) III. Show Description
Weak recessive allele of mua-3. 40% have muscle detachment from cuticle in adults, primarily in head, results in weak bent head phenotype. 60% are wild type.
OT150 C. elegans mua-10(rh267) X. Show Description
Larvae essentially wild type, adults have bent-head phenotype.
OW1603 C. elegans dvIs15. Show Description
dvIs15 [unc-54(vector) + mtl-2::GFP]. Control strain for OW1601. Phenotype apparently Wild-type. Parental strain CL2122 out-crossed 6x to N2. Reference: Koopman M, et al. MicroPubl Biol. 2023 Apr 19:2023:10.17912/micropub.biology.000766. doi: 10.17912/micropub.biology.000766. eCollection 2023. PMID: 37151213.
PB303 C. elegans Show Description
Caenorhabditis elegans from association with a terrestrial isopod, Porcellio scaber, that was obtained from Ward's Biological Supply. Species ID confirmed by mating tests with JK574 fog-2(q71). Caenorhabditis elegans wild isolate.
PB306 C. elegans Show Description
Caenorhabditis elegans from association with a terrestrial isopod, Porcellio scaber, that was obtained from Connecticut Valley Biological Supply. Species ID confirmed by mating tests with JK574 fog-2(q71). Caenorhabditis elegans wild isolate.
PB826 C. briggsae Show Description
Wild type isolate of Caenorhabditis briggsae that was obtained from association with a snail in Hueston Woods State Park in Ohio. Species ID confirmed by mating test with AF16.
PD126 C. elegans unc-54(e190) I; ccIs126. Show Description
ccIs126 [myo-2p::lacZ + unc-54(+)]. lacZ expression in pharyngeal and body wall muscles. Superficially wild-type, but gives some paralyzed animals.
PD2546 C. elegans unc-60(gk239) fau-1(cc2530)/nT1 [qIs51] (IV;V). Show Description
qIs51 [myo-2p::GFP + pes-10p::GFP + F22B7.9p::GFP]. Maintain at 20C or lower. Heterozygotes are wild-type GFP+ and segregate non-GFP unc-60(gk239) fau-1(cc2530) homozygotes (larval arrest), wild-type GFP+ heterozygotes, and arrested nT1[qIs51] aneuploids. Note: unc-60(gk239) fau-1(cc2530)/nT1 [qIs51] heterozygotes are are developmentally delayed. Pick wild-type GFP+ and check for correct segregation of progeny to maintain. cc2530 is a nonsense mutation converting the leucine codon at position 5 to a premature stop codon. fau-1 also known as rps-30. Reference: Cenik ES, et al. Dev Cell. 2019 Mar 25;48(6):811-826.e6. doi: 10.1016/j.devcel.2019.01.019. PMID: 30799226.
PD2557 C. elegans rps-10(cc2557)/tmC20 [unc-14(tmIs1219) dpy-5(tm9715)] I. Show Description
Balancer recombination happens frequently at 23-25C, strain must be maintained at 16-20C. Homozygous lethal mutation balanced by Dpy- and myo-2p::Venus-marked inversion. Heterozygotes are non-Dpy with relatively dim pharyngeal GFP (Venus) expression, and segregate heterozygous non-Dpy Venus+, non-Venus cc2557 homozygotes (L1 arrest), and Dpy with brighter Venus+ (tmC20 homozygotes). Pick wild-type Venus(+) and check for proper segregation of progeny to maintain. cc2557 is an engineered mutation creating an early stop (T8*). Presumptive rps-10 null. Heterozygous rps-10(cc2557)/tmC20 animals are delayed in development. Reference: Cenik ES, et al. Dev Cell. 2019 Mar 25;48(6):811-826.e6. doi: 10.1016/j.devcel.2019.01.019. PMID: 30799226.
PD2558 C. elegans rpl-33(cc2558)/mIn1 [dpy-10(e128) mIs14] II. Show Description
Balancer recombination happens frequently at 23-25C, strain must be maintained at 16-20C. Homozygous lethal mutation balanced by Dpy- and myo-2p::GFP-marked inversion. Heterozygotes are wild-type with pharyngeal GFP signal, and segregate wild-type GFP+, Dpy bright GFP+ (mIn1 homozygotes), and non-GFP rpl-33(cc2558) homozygotes. Pick wild-type GFP+ to maintain. cc5998 is an engineered mutation creating an early stop (R9*). Presumptive rpl-33 null. Heterozygous rpl-33(cc2558)/mIn1 animals are delayed in development. Check for proper segregation of progeny. Reference: Cenik ES, et al. Dev Cell. 2019 Mar 25;48(6):811-826.e6. doi: 10.1016/j.devcel.2019.01.019. PMID: 30799226.
PD2620 C. elegans ccDf2620/unc-54(e1152) I. Show Description
Heterozygotes are wild-type and should segregate wild-type (ccDf2620/unc-54(e1152) heterozygotes), Unc (unc-54(e1152) homozygotes), and ccDf2620 homozygotes (larval arrest around L1 stage). Maintain by picking heterozygotes and checking for proper segregation of progeny. ccDf2620 removes the rDNA repeats at the end of chromosome I. Reference: Cenik ES, et al. Dev Cell. 2019 Mar 25;48(6):811-826.e6. doi: 10.1016/j.devcel.2019.01.019. PMID: 30799226.
PD4788 C. elegans mIs13 I. Show Description
mIs13 [myo-2p::GFP + pes-10p::GFP + gut-promoter::GFP] I. Superficially wild-type. GFP expression in 4-cell embryos, pharyngeal muscle and gut. GFP signal is dim but visible under dissecting scope. See WBG 15 #5 page 20.
PD5994 C. elegans rps-23(cc5994)/tmC5 [F36H1.3(tmIs1220)] IV. Show Description
Balancer recombination happens frequently at 23-25C, strain must be maintained at 16-20C. Homozygous lethal mutation balanced by myo-2p::Venus-marked inversion. Heterozygotes are wild-type with somewhat dimmer Venus signal and segregate WT Venus(+) heterozygotes, Mec Unc Venus(+) tmC5 homozygotes, and non-Venus rps-23(cc5994) homozygotes (L1 arrest). Pick wild-type Venus(+) and check for proper segregation of progeny to maintain. cc5994 is an engineered mutation creating an early stop (A67*). Presumptive rps-23 null. Heterozygous rps-23(cc5994)/tmC5 animals are delayed in development. Check for proper segregation of progeny. Reference: Cenik ES, et al. Dev Cell. 2019 Mar 25;48(6):811-826.e6. doi: 10.1016/j.devcel.2019.01.019. PMID: 30799226.
PD5998 C. elegans rpl-5(cc5998)/mIn1 [dpy-10(e128) mIs14] II. Show Description
Balancer recombination happens frequently at 23-25C, strain must be maintained at 16-20C. Homozygous lethal mutation balanced by Dpy- and myo-2p::GFP-marked inversion. Heterozygotes are wild-type with pharyngeal GFP signal, and segregate wild-type GFP+, Dpy bright GFP+ (mIn1 homozygotes), and non-GFP rpl-5(cc5998) homozygotes. Pick wild-type GFP+ to maintain. cc5998 is an engineered mutation creating an early stop (A166*). Presumptive rpl-5 null. Heterozygous rpl-5(cc5998)/mIn1 animals are delayed in development. Check for proper segregation of progeny. Reference: Cenik ES, et al. Dev Cell. 2019 Mar 25;48(6):811-826.e6. doi: 10.1016/j.devcel.2019.01.019. PMID: 30799226.
PD8118 C. elegans smg-1(cc546) unc-54(r293) I. Show Description
Temperature sensitive. Partially suppressed Unc at 25C. Unc at 16C. [NOTE: The temperature-sensitive allele cc546 causes an M1957L change in SMG-1. The lesion is an atg>ttg transversion in exon 35. Flanking sequences follow with the mutation site indicated with a capital A: ttggtggtcggttacaaaacgatattcaaga tcactggcagtcatgagtAtggttggatcagttttaggactcggtgatcg acatttggacaatttattg The lesion is detectable via SNP-snip with the mutation causing loss of an MslI site. Primers are for a 323 bp product. Digest with MslI to 86+237 in the wild type, uncut as 323 in the mutant. DJR701(f): CAGTCGTGAGCTTTGGATGCGTGC DJR702(r): TCGGGGATACGCAGATTCTTTCCC. Pedone ... Reiner G3 (2021).]
PD8120 C. elegans smg-1(cc546) I. Show Description
Temperature sensitive. [NOTE: The temperature-sensitive allele cc546 causes an M1957L change in SMG-1. The lesion is an atg>ttg transversion in exon 35. Flanking sequences follow with the mutation site indicated with a capital A: ttggtggtcggttacaaaacgatattcaaga tcactggcagtcatgagtAtggttggatcagttttaggactcggtgatcg acatttggacaatttattg The lesion is detectable via SNP-snip with the mutation causing loss of an MslI site. Primers are for a 323 bp product. Digest with MslI to 86+237 in the wild type, uncut as 323 in the mutant. DJR701(f): CAGTCGTGAGCTTTGGATGCGTGC DJR702(r): TCGGGGATACGCAGATTCTTTCCC. Pedone ... Reiner G3 (2021).]