| BAN713 |
C. elegans |
bcl-11(bon125) V. Show Description
bcl-11(bon125) is a CRISPR/Cas9-engineered allele causing a frameshift mutation resulting in a variant with intact C2H2-type Znf domains but with an insertion of ∼64 amino acids after proline 592. Genotyping primers: Fw CGACGTGCTTCACCGGAAGA and Rev GGCGTAGTCTGGGACATCATATGGA; bcl-11(bon125): 207 bp; WT: NO PRODUCT. Reference: Niedworok P, et al. 2026 Jan 7;29(2):114422. doi: 10.1016/j.isci.2025.114422. PMID: 41641102. |
|
| BAN728 |
C. elegans |
bcl-11(bon144) V. Show Description
bcl-11(bon144) is an in-frame insertion/deletion that was generated by CRISPR/Cas9-mediated gene editing. Genotyping primers:Fw GGGGGTTTCTGGTGTCGAATCAAC and Rev CCTTCTCAATGAAGTTAGAGAAGCAAGAAAGG; bcl-11(bon144): 184 bp; WT: NO PRODUCT. Reference: Niedworok P, et al. 2026 Jan 7;29(2):114422. doi: 10.1016/j.isci.2025.114422. PMID: 41641102. |
|
| BAN925 |
C. elegans |
bcl-11(bon172) V/nT1[umnIs49] (IV;V). Show Description
umnIs49 [myo-2p::mKate2 + NeoR, V: 1005689 (intergenic)] IV. Heterozygotes are wild-type mKate2+ and segregate wild-type mKate2+, very few non-mKate arrested larvae (bon145 homozygotes mostly Emb), Vul mKate2+ (nT1 homozygotes) and dead eggs (aneuploids). Maintain by picking wild-type mKate2+. bcl-11(bon172) is a CRISPR/Cas9-engineered deletion causing truncation of BCL-11 lacking ∼196 amino acids and carrying a predicted triple HA sequence (3xHA) at the C terminus. Genotyping primers: Fw GTGAGCTTGCTGAGCCAGCT and Rev CGGGTAAGAGAAGATTGAGCGCAA; bcl-11(bon172): ~250 bp; WT: NO PRODUCT. Reference: Niedworok P, et al. 2026 Jan 7;29(2):114422. doi: 10.1016/j.isci.2025.114422. PMID: 41641102. |
|
| OK461 |
C. elegans |
bcl-11(cu10)/unc-46(e177) dpy-11(e224) V. Show Description
Pick wild-type to maintain. Heterozygotes are wild-type and should segregate wild-type heterozygotes, bcl-11 homozygotes (L1 larval arrest with starved appearance), and Dpy Unc homozygotes (Medium Dpy, Shrinker, poor backing). Maintain by picking wild-type and scoring for proper segregation of progeny. bcl-11 homozygotes have weak pharyngeal muscle contractions and pharyngeal lumen fails to open. cu10 is a 555 bp deletion (V:6360921..6361460). Predicted bcl-11 null allele. Reference: Vilimas, Tomas. (2004). Genes regulating ceh-22 and pharyngeal development of Caenorhabditis elegans.. University of Illinois at Chicago. Thesis. https://hdl.handle.net/10027/12060 |
|
