| PFR60 |
C. elegans |
hpl-1(tm1624) X. Show Description
Wild type phenotype.
|
|
| PG-1 |
Unknown species |
Show Description
Not interfertile with N2. Growth slow. Morphogenesis differs from N2. Collected by M.GALLO. PG-1, -2, -3 appear to be the same species. (Carl Johnson 6/26/93).
|
|
| PG-2 |
Unknown species |
Show Description
Not interfertile with N2. Growth slow. Morphogenesis differs from N2. Collected by M.GALLO. PG-1, -2, -3 appear to be the same species. (Carl Johnson 6/26/93).
|
|
| PG-3 |
Unknown species |
Show Description
Not interfertile with N2. Growth slow. Morphogenesis differs from N2. Collected by M.GALLO. PG-1, -2, -3 appear to be the same species. (Carl Johnson 6/26/93).
|
|
| PHX1551 |
C. elegans |
ceh-51(syb1551[ceh-51::GFP]) V. Show Description
Superficially wild-type. Insertion of GFP and FLAG tags directly before the stop codon of endogenous ceh-51 locus. Verified by sequencing. Reference: Reilly MB, et al. Nature. 2020 Aug;584(7822):595-601. PMID: 32814896.
|
|
| PHX1587 |
C. elegans |
tab-1(syb1587[tab-1::GFP]) II. Show Description
Superficially wild-type. Insertion of GFP and FLAG tags directly before the stop codon of endogenous tab-1 locus. Verified by sequencing. Reference: Reilly MB, et al. Nature. 2020 Aug;584(7822):595-601. PMID: 32814896.
|
|
| PHX1592 |
C. elegans |
ceh-5(syb1592[ceh-5::GFP]) I. Show Description
Superficially wild-type. Insertion of GFP and FLAG tags directly before the stop codon of endogenous ceh-5 locus. Verified by sequencing. Reference: Reilly MB, et al. Nature. 2020 Aug;584(7822):595-601. PMID: 32814896.
|
|
| PHX1610 |
C. elegans |
ceh-92(syb1610[ceh-92::GFP]) III. Show Description
Superficially wild-type. Insertion of GFP and FLAG tags directly before the stop codon of endogenous ceh-92 locus. Verified by sequencing. Reference: Reilly MB, et al. Nature. 2020 Aug;584(7822):595-601. PMID: 32814896.
|
|
| PHX1656 |
C. elegans |
ceh-8(syb1656[ceh-8::GFP]) I. Show Description
Superficially wild-type. Insertion of GFP and FLAG tags directly before the stop codon of endogenous ceh-8 locus. Verified by sequencing. Reference: Reilly MB, et al. Nature. 2020 Aug;584(7822):595-601. PMID: 32814896.
|
|
| PHX1658 |
C. elegans |
unc-4(syb1658[unc-4::GFP]) II. Show Description
Superficially wild-type. Insertion of GFP and FLAG tags directly before the stop codon of endogenous unc-4 locus. Verified by sequencing. Reference: Reilly MB, et al. Nature. 2020 Aug;584(7822):595-601. PMID: 32814896.
|
|
| PHX1679 |
C. elegans |
ttx-1(syb1679[ttx-1::GFP]) V. Show Description
Superficially wild-type. Insertion of GFP and FLAG tags directly before the stop codon of endogenous ttx-1 locus. Verified by sequencing. Reference: Reilly MB, et al. Nature. 2020 Aug;584(7822):595-601. PMID: 32814896.
|
|
| PHX1849 |
C. elegans |
ceh-23(syb1849[ceh-23::GFP)] III. Show Description
Superficially wild-type. Insertion of GFP and FLAG tags directly before the stop codon of endogenous ceh-23 locus. Verified by sequencing. Reference: Reilly MB, et al. Nature. 2020 Aug;584(7822):595-601. PMID: 32814896.
|
|
| PHX1884 |
C. elegans |
ceh-75(syb1884[ceh-75::GFP]) V. Show Description
Superficially wild-type. Insertion of GFP and FLAG tags directly before the stop codon of endogenous ceh-75 locus. Verified by sequencing. Reference: Reilly MB, et al. Nature. 2020 Aug;584(7822):595-601. PMID: 32814896.
|
|
| PHX1955 |
C. elegans |
ceh-87(syb1995[ceh-87::GFP]) II. Show Description
Superficially wild-type. Insertion of GFP and FLAG tags directly before the stop codon of endogenous ceh-87 locus. Verified by sequencing. Reference: Reilly MB, et al. Nature. 2020 Aug;584(7822):595-601. PMID: 32814896.
|
|
| PHX2015 |
C. elegans |
ceh-58(syb2015[ceh-58::GFP]) II. Show Description
Superficially wild-type. Insertion of GFP and FLAG tags directly before the stop codon of endogenous ceh-58 locus. Verified by sequencing. Reference: Reilly MB, et al. Nature. 2020 Aug;584(7822):595-601. PMID: 32814896.
|
|
| PHX209 |
C. elegans |
R12G8.1(syb209) V. Show Description
Complete CRISPR/Cas-9 knock-out (1143bp deletion) of the gene R12G8.1. Homozygous. Superficial wild-type.
Primers for crossing:
Fwd: agctccggggacatcaaata
InFwd: CTGAAAACTCGTCGTAGCCG
Rev: tcagaggtccgtggttcaaa
Wild-type bands: 402bp, 1427bp. Mutation band: 284bp.
|
|
| PHX2517 |
C. elegans |
ceh-86(syb2517[ceh-86::GFP::FLAG]) II. Show Description
Superficially wild-type. Insertion of GFP and FLAG tags directly before the stop codon of endogenous ceh-86 locus. Verified by sequencing. Reference: Reilly MB, et al. Nature. 2020 Aug;584(7822):595-601. PMID: 32814896.
|
|
| PHX2587 |
C. elegans |
wac-1.1&wac-1.2(syb2587) I. Show Description
Superficially wild-type. Deletion removes of wac-1.1/Y40B1A.1 and wac-1.2/Y40B1A.3 (I:13344075 to 13358647, version WS276, PRJNA13758).
|
|
| PHX3293 |
C. elegans |
bli-2(syb3293[bli-2::mNG]) II. Show Description
mNeonGreen tag inserted at C-terminus of endogenous bli-2 locus. Superficially wild-type with green fluorescence in L4 epidermis and adult stage cuticle. Reference: Adams JRG, et al. Nat Commun. 2023 Nov 18;14(1):7506. doi: 10.1038/s41467-023-43058-9. PMID: 37980413.
|
|
| PHX3601 |
C elegans |
pah-1(syb3601) II. Show Description
Superficially wild-type; decreased production of serotonin-derived metabolites; increase in exploration. CRISPR-mediated deletion removing 1450 bp spans Exon 1 to Exon 6. Upstream flanking sequence: cctctgaaaaccaaatcttgttctctgaaa; Downstream flanking sequence: TCGCTGGTCTTCTTTCTTCTCGTGATTTCT.
|
|
| PHX3634 |
C elegans |
pah-1(syb3634[GFP::H2B::T2A::pah-1]) II. Show Description
Superficially wild-type. GFP tag inserted into endogenous pah-1 locus by CRISPR/Cas9.
|
|
| PHX4698 |
C. elegans |
cat-2(syb4698[cat-2::T2A::NeonGreen]) II. Show Description
NeonGreen tag inserted into endogenous cat-2 locus. NeonGreen expression in dopaminergic neurons. Superficially wild type. Reference: Jimeno-MartÃn A, et al. Genome Res. 2022 Mar;32(3):459-473. PMID: 35074859.
|
|
| PHX530 |
C. elegans |
nlp-11(syb530) II. Show Description
Superficially wild-type. syb530 is a 2042 bp deletion of the entire nlp-11 gene. Flanking sequences: tatttctcctattgagtgcaaaaaagagtgaaa-acatcaacaaataaaataccataccaacgagt Primers for genotyping: Fwd: gtcctcaccattcccctagg Interal (fwd): TCTGATCGACGCTGGAAAGA Rev: gaataggaagagggcggagg PCR product: WT 264 bp / syb530 -- ; WT 2551 bp / syb530 509 bp. Reference: Konietzka J, et al. Curr Biol. 2020 Jan 6;30(1):1-16.e13. doi: 10.1016/j.cub.2019.10.048. PMID: 31839447
|
|
| PJ1043 |
C. elegans |
tpa-1(k501) IV; ccIs55 V. Show Description
ccIs55 [unc-54::lacZ + sup-7(st5)] V. Superficially wild-type. Resistant to PMA.
|
|
| PK2010 |
C. elegans |
rhr-2(ok403) V. Show Description
Wild type phenotype.
|
|
| PK2016 |
C. elegans |
rhr-1(ok432) V. Show Description
Wild type phenotype.
|
|
| PS10001 |
C. elegans |
F49B2.6(sy2028) I. Show Description
Superficially wild type. CRISPR/Cas9 engineered STOP-IN null mutant of F49B2.6. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: cagCGATCTGGACGCCCAGCAACCCCTACCGCCA. Right flanking sequence: CACCTCATCCCACCGTCGAACCCGTGTATGTGTCG. Inserted sequence between the two-flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: GACGGTGGGATGAGGTGTGG. Method Reference: Wang H, et al. G3 (Bethesda). 2018 Nov 6;8(11):3607-3616.
|
|
| PS10012 |
C. elegans |
F31E8.4(sy2030) II. Show Description
Superficially wild type. CRISPR/Cas9 engineered STOP-IN null mutant of F31E8.4. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: GATTCTCTTCAGCTGGTGGAAAACTGGATCTCT. Right flanking sequence: GTCTGgtaagtctatatacttcggacacattcaaatttg. Inserted sequence between the two-flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: TGGAAAACTGGATCTCTGTC. Method Reference: Wang H, et al. G3 (Bethesda). 2018 Nov 6;8(11):3607-3616.
|
|
| PS10014 |
C. elegans |
F54G2.1(sy2032) X. Show Description
Superficially wild type. CRISPR/Cas9 engineered STOP-IN null mutant of F54G2.1. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: cctgccaaaccgatgttttattgcagAGTCCAAGC. Right flanking sequence: GTCAGATGGGAACTTTTTCGAAAAAGTAACTGCTC. Inserted sequence between the two-flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: AAAAGTTCCCATCTGACGCT. Method Reference: Wang H, et al. G3 (Bethesda). 2018 Nov 6;8(11):3607-3616.
|
|
| PS10016 |
C. elegans |
F53A10.2(sy2034) II. Show Description
Superficially wild type. CRISPR/Cas9 engineered STOP-IN null mutant of F53A10.2. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: gatcATGTTCCACGTGTCAACAATGCTACCGTATAC. Right flanking sequence: TATTGGAGACGCCCAGCAGCTTCAAAGAAAACGG. Inserted sequence between the two-flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: ACAATGCTACCGTATACTAT. Method Reference: Wang H, et al. G3 (Bethesda). 2018 Nov 6;8(11):3607-3616.
|
|
| PS10018 |
C. elegans |
F36G3.3(sy2036) X. Show Description
Superficially wild type. CRISPR/Cas9 engineered STOP-IN null mutant of F36G3.3. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: CCGGATTACGCACCCACACAGCCCGTGTACCATCC. Right flanking sequence: AAGCAGTCATGTAACAGCTCCACCGTACCATTACC. Inserted sequence between the two-flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: CTGTTACATGACTGCTTGGA. Method Reference: Wang H, et al. G3 (Bethesda). 2018 Nov 6;8(11):3607-3616.
|
|
| PS10020 |
C. elegans |
F53H1.3(sy2038) IV. Show Description
Superficially wild type. CRISPR/Cas9 engineered STOP-IN null mutant of F53H1.3. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: GGAGCCGGATATTGAGCCATGGGACCGGTTTCGC. Right flanking sequence: GACTGGCTTCACTGCATTTGTGTGGTCACGTTTG. Inserted sequence between the two-flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: CATGGGACCGGTTTCGCGAC. Method Reference: Wang H, et al. G3 (Bethesda). 2018 Nov 6;8(11):3607-3616.
|
|
| PS10022 |
C. elegans |
F56F10.1(sy2040) X. Show Description
Superficially wild type. CRISPR/Cas9 engineered STOP-IN null mutant of F56F10.1. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: cttttttgaattctagTCACCATTTGGACCGGTT. Right flanking sequence: AACAGCGTCTGATGGGGCAAGCATTCAAGAGACTTAC. Inserted sequence between the two-flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: CCCCATCAGACGCTGTTAAC. Method Reference: Wang H, et al. G3 (Bethesda). 2018 Nov 6;8(11):3607-3616.
|
|
| PS10060 |
C. elegans |
F58G6.3(sy2042) IV. Show Description
Superficially wild type. CRISPR/Cas9 engineered STOP-IN null mutant of F58G6.3. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: CATAATTCAATGGATATGGACATGAATCAAGGACCTTTC. Right flanking sequence: ATGTGGATGTGGTTTCATACAAAACCACAAGAC. Inserted sequence between the two-flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: TGAAACCACATCCACATGAA. Method Reference: Wang H, et al. G3 (Bethesda). 2018 Nov 6;8(11):3607-3616.
|
|
| PS10062 |
C. elegans |
M03C11.1(sy2044) III. Show Description
Superficially wild type. CRISPR/Cas9 engineered STOP-IN null mutant of M03C11.1. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: GTCTTCAGCATTTTTCAGTCATACGGAGCATT. Right flanking sequence: GGGCGGGGAGCTTTTGGAAAAgttagttggttttttttg. Inserted sequence between the two-flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: CAGTCATACGGAGCATTGGG. Method Reference: Wang H, et al. G3 (Bethesda). 2018 Nov 6;8(11):3607-3616.
|
|
| PS10064 |
C. elegans |
R12C12.5(sy2046) II. Show Description
Superficially wild type. CRISPR/Cas9 engineered STOP-IN null mutant of R12C12.5. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: CAAGGAGAAGATCAAGGAAAAAAGCCGTAAGA. Right flanking sequence: GGAAGGCTCCAACTGCAGATGAAGCAATTGGAAATTTG. Inserted sequence between the two-flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: GGAAAAAAGCCGTAAGAGGA. Method Reference: Wang H, et al. G3 (Bethesda). 2018 Nov 6;8(11):3607-3616.
|
|
| PS10066 |
C. elegans |
F59C12.3(sy2048) X. Show Description
Superficially wild type. CRISPR/Cas9 engineered STOP-IN null mutant of F59C12.3. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: CAGCGACGAGTGCATGCAGTGCCACCGACACCCATGT. Right flanking sequence: ATCAGGGAGAGACGAACATTTTAGACTCACTTC. Inserted sequence between the two-flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: GCCACCGACACCCATGTATC. Method Reference: Wang H, et al. G3 (Bethesda). 2018 Nov 6;8(11):3607-3616.
|
|
| PS10068 |
C. elegans |
R08E3.3(sy2050) X. Show Description
Superficially wild type. CRISPR/Cas9 engineered STOP-IN null mutant of R08E3.3. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: GATGCTTTCATCAGAGACGCTTGCCGACATCTT. Right flanking sequence: GAGTGgtatgttttttgtctgaaatctaattttattc. Inserted sequence between the two-flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: ACGCTTGCCGACATCTTGAG. Method Reference: Wang H, et al. G3 (Bethesda). 2018 Nov 6;8(11):3607-3616.
|
|
| PS10155 |
C. elegans |
T05C3.6(sy2066) V. Show Description
Superficially wild type. CRISPR/Cas9 engineered STOP-IN null mutant of T05C3.6. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: GTCATTCAATAGTTGCTATTGTGGCAGTGATTATAA. Right flanking sequence: CAACGGCAATATGGCTCACGgttagtttaaatatc. Inserted sequence between the two-flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: TGTGGCAGTGATTATAACAA. Method Reference: Wang H, et al. G3 (Bethesda). 2018 Nov 6;8(11):3607-3616.
|
|
| PS10157 |
C. elegans |
R12C12.6(sy2068) II. Show Description
Superficially wild type. CRISPR/Cas9 engineered STOP-IN null mutant of R12C12.6. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: GGATGCATTTCTTGCAAATTGCGACTGCCGTTA. Right flanking sequence: TGAGTCACGAAACACTGTGCTCTTAAAAGTAGTTG. Inserted sequence between the two-flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: CAGTGTTTCGTGACTCATAA. Method Reference: Wang H, et al. G3 (Bethesda). 2018 Nov 6;8(11):3607-3616.
|
|
| PS10158 |
C. elegans |
T05E12.3(sy2069) V. Show Description
Superficially wild type. CRISPR/Cas9 engineered STOP-IN null mutant of T05E12.3. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: ATATTTTTAATATTTTTTATTTTTCGACTCCAGGC. Right flanking sequence: GCAAGgtaagtaagaattattgttttttatttatt. Inserted sequence between the two-flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: ATTCTTACTTACCTTGCGCC. Method Reference: Wang H, et al. G3 (Bethesda). 2018 Nov 6;8(11):3607-3616.
|
|
| PS10160 |
C. elegans |
T05E7.3(sy2072) I. Show Description
Superficially wild type. CRISPR/Cas9 engineered STOP-IN null mutant of T05E7.3. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: CAAAAGAAGCAGAGATAATTAATGGTGAAACCAGAA. Right flanking sequence: TGGATGTGAACAGAACATCCGAACTCGAGgtttta. Inserted sequence between the two-flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: TGTTCTGTTCACATCCATTC. Method Reference: Wang H, et al. G3 (Bethesda). 2018 Nov 6;8(11):3607-3616.
|
|
| PS10162 |
C. elegans |
nlp-50(sy2074) II. Show Description
Superficially wild type. CRISPR/Cas9 engineered STOP-IN null mutant of nlp-50. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: gcagtttcacacaaaccATGCGCTTCTCCGTCT. Right flanking sequence: TTGTTGCTCTATTTGCTCTTCTTGCTGTCTCTTATG. Inserted sequence between the two-flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: AGCAAATAGAGCAACAAAGA. Method Reference: Wang H, et al. G3 (Bethesda). 2018 Nov 6;8(11):3607-3616.
|
|
| PS10163 |
C. elegans |
T08G3.13(sy2075) V. Show Description
Superficially wild type. CRISPR/Cas9 engineered STOP-IN null mutant of T08G3.13. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: ctattttgattgaattATGTCTGTTATCGAGTTATGTGT. Right flanking sequence: CGGAGGACAGAAGTTCACAACGACGAAAACTAC. Inserted sequence between the two-flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: GTTATCGAGTTATGTGTCGG. Method Reference: Wang H, et al. G3 (Bethesda). 2018 Nov 6;8(11):3607-3616.
|
|
| PS10165 |
C. elegans |
nlp-51(sy2053) II. Show Description
Superficially wild type. CRISPR/Cas9 engineered STOP-IN null mutant of nlp-51. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: gtttttcttcagtttcaaatcaaaATGCGATTCCTCA. Right flanking sequence: TCTTGGCTCTCCTCGTGCTCTTCGCCATCACCC. Inserted sequence between the two-flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: CAAAATGCGATTCCTCATCT. Method Reference: Wang H, et al. G3 (Bethesda). 2018 Nov 6;8(11):3607-3616.
|
|
| PS10170 |
C. elegans |
gldi-2(sy2058) II. Show Description
T13C2.6. Superficially wild type. CRISPR/Cas9 engineered STOP-IN null mutant of gldi-2. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: CTGATTTCAATGGCCACCATTTCGGTGGGCCTCCA. Right flanking sequence: ACCGATGGGAGCACCTACAAGAAgtatgttttc. Inserted sequence between the two-flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: TAGGTGCTCCCATCGGTTGG. Method Reference: Wang H, et al. G3 (Bethesda). 2018 Nov 6;8(11):3607-3616.
|
|
| PS10497 |
C. elegans |
gst-25(sy2221) I. Show Description
Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of gst-25. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). left flanking sequence: GTGACTTATCAAAATGACCCTTAAATTCTCCTACT. right flanking sequence: TTGGAACCCGCGGTATCGGTGAGCCGATTCGTATG. inserted sequence between the two-flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA : GATACCGCGGGTTCCAAAGT. Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616
|
|
| PS10501 |
C. elegans |
pam-1(sy2224) IV. Show Description
Superficially wild-type but reduced brood size/early eggs laid/fewer viable eggs. CRISPR/Cas9 engineered STOP-IN null mutant of pam-1. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). left flanking sequence: CTTTTCAGAATGGCGGCCTGTGGAAACCCAAGCG. right flanking sequence: CGGCGGTCAAATTTGAGAGGCTTCCAACATTCGCC. inserted sequence between the two-flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA : CTGTGGAAACCCAAGCGCGG. Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616
|
|
| PS10686 |
C. elegans |
nas-22(sy2303) V. Show Description
Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of nas-22. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). left flanking sequence: TTTTATTCTTCTCTCAATTTTACAAGAGTGCTATG. right flanking sequence: GAAAGGATATTGTTGCAAGAATTGGTGGAAGAAATG. inserted sequence between the two-flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA : TTTACAAGAGTGCTATGGAA. Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616
|
|
| PS1162 |
Panagrolaimus sp. |
Panagrolaimus sp. Show Description
Wild-type Panagrolaimus isolated in Beijing, China, 1991. Male-female strain.
|
|
