Strain Information

Name PD8118   View On Wormbase
Species C. elegans
Genotypesmg-1(cc546) unc-54(r293) I.
DescriptionTemperature sensitive. Partially suppressed Unc at 25C. Unc at 16C. [NOTE: The temperature-sensitive allele cc546 causes an M1957L change in SMG-1. The lesion is an atg>ttg transversion in exon 35. Flanking sequences follow with the mutation site indicated with a capital A: ttggtggtcggttacaaaacgatattcaaga tcactggcagtcatgagtAtggttggatcagttttaggactcggtgatcg acatttggacaatttattg The lesion is detectable via SNP-snip with the mutation causing loss of an MslI site. Primers are for a 323 bp product. Digest with MslI to 86+237 in the wild type, uncut as 323 in the mutant. DJR701(f): CAGTCGTGAGCTTTGGATGCGTGC DJR702(r): TCGGGGATACGCAGATTCTTTCCC. Pedone ... Reiner G3 (2021).]
Mutagen
Laboratory PD
Sign in or register an account if you want to order this strain.