Strain Information
| Name | PD8120 View On Wormbase |
|---|---|
| Species | C. elegans |
| Genotype | smg-1(cc546) I. |
| Description | Temperature sensitive. [NOTE: The temperature-sensitive allele cc546 causes an M1957L change in SMG-1. The lesion is an atg>ttg transversion in exon 35. Flanking sequences follow with the mutation site indicated with a capital A: ttggtggtcggttacaaaacgatattcaaga tcactggcagtcatgagtAtggttggatcagttttaggactcggtgatcg acatttggacaatttattg The lesion is detectable via SNP-snip with the mutation causing loss of an MslI site. Primers are for a 323 bp product. Digest with MslI to 86+237 in the wild type, uncut as 323 in the mutant. DJR701(f): CAGTCGTGAGCTTTGGATGCGTGC DJR702(r): TCGGGGATACGCAGATTCTTTCCC. Pedone ... Reiner G3 (2021).] |
| Mutagen | EMS |
| Outcrossed | x2 |
| Made by | Getz and Fire |
| Laboratory | PD |
Sign in
or
register an account if you want to order this strain.