e2008 recessively suppresses the phenotypes of mutations in unc-54(r293), lin-29(n546), tra-2 and dpy-5. Abnormal male tail. smg-2 homozygotes have slightly abnormal movement.

Heterozygotes are WT and segregate WT, Unc, and early larval lethal.

Dpy. Unc-paralyzed coiler.

Him. Temperature-sensitive embryonic lethal. Maintain at 15C. Reference: O'Rourke SM, et al. PLoS One. 2011 Mar 1;6(3):e16644.

Temperature sensitive. Partially suppressed Unc at 25C. Unc at 16C. [NOTE: The temperature-sensitive allele cc545 causes a T761I change in SMG-1. The lesion is a aca>ata transition in exon 35. Flanking sequences follow with the mutation site indicated with a capital C: tggattattaatcagact gcaaacttttgcattgtgaataaaatgaagaCaccattaggaaaaccaat gcagacttttgcagcttttgagaatgaaatta Pedone ... Reiner G3 (2021).]

Temperature sensitive. Partially suppressed Unc at 25C. Unc at 16C. [NOTE: The temperature-sensitive allele cc546 causes an M1957L change in SMG-1. The lesion is an atg>ttg transversion in exon 35. Flanking sequences follow with the mutation site indicated with a capital A: ttggtggtcggttacaaaacgatattcaaga tcactggcagtcatgagtAtggttggatcagttttaggactcggtgatcg acatttggacaatttattg The lesion is detectable via SNP-snip with the mutation causing loss of an MslI site. Primers are for a 323 bp product. Digest with MslI to 86+237 in the wild type, uncut as 323 in the mutant. DJR701(f): CAGTCGTGAGCTTTGGATGCGTGC DJR702(r): TCGGGGATACGCAGATTCTTTCCC. Pedone ... Reiner G3 (2021).]

P-Vul.

P-vul.

P-Vul.

P-vul.

P-vul. WT movement.

P-Vul. WT movement.

P-Vul. WT movement.