| NIC1581 |
C. sp. 43 |
Caenorhabditis sp. 43 wild isolate. Show Description
Do not keep below 20C. Male-Female strain. Reference isolate for Caenorhabditis sp. 43 genome sequence. Inbred derivative of NIC1070 (25 generations of inbreeding).
|
|
| NIC203 |
C. tropicalis |
Caenorhabditis tropicalis wild isolate. Show Description
Caenorhabditis tropicalis wild isolate. Reference: Toker IA, et al. bioRxiv 2024.11.23.624988; doi: https://doi.org/10.1101/2024.11.23.624988.
|
|
| NIC564 |
C. waitukubuli |
Caenorhabditis waitukubuli wild isolate. Show Description
Do not keep below 20°C. Male-female. Caenorhabditis sp. 39 wild isolate. Gonochoristic species; isofemale line. Isolated from rotting Clusia fruits on the island of Dominica (2014). Previously known as Caenorhabditis sp. 39.
|
|
| NK1339 |
C. elegans |
rrf-3(pk1426) II; qyIs127 V; qyIs166 X. Show Description
qyIs127 [lam-1p::lam-1::mCherry + unc-119(+)] V. qyIs166 [cdh-3p::GFP::CAAX + unc-119(+)] X. Temperature-sensitive sterile; maintain at 20C or lower for optimum fertility. Increased sensitivity to RNAi when compared to wild-type animals. lam-1p::lam-1::mCherry expression can be weak and variable. Reference: Kelley, LC, et al. Developmental Cell. 2019 Feb 11;48(3):313-328.e8.
|
|
| NK2318 |
C. elegans |
dgn-1(qy18[dgn-1::mNG]) X. Show Description
Superficially wild-type. Reference: Jayadev R, et al. J Cell Biol. 2019 Aug 6. pii: jcb.201903124. doi: 10.1083/jcb.201903124.
|
|
| NK2322 |
C. elegans |
cle-1(qy22[cle-1::mNG+loxP]) I. Show Description
Superficially wild-type. CRISPR/Cas9 insertion of mNeonGreen. Insertion site verified by PCR and sequencing.
|
|
| NK2324 |
C. elegans |
ina-1(qy23[ina-1::mNG]) III. Show Description
Superficially wild-type. Reference: Jayadev R, et al. J Cell Biol. 2019 Aug 6. pii: jcb.201903124. doi: 10.1083/jcb.201903124.
|
|
| NK2326 |
C. elegans |
emb-9(qy24[emb-9::mNG+loxP]) III. Show Description
Superficially wild-type. Slow growth. CRISPR/Cas9 insertion of mNeonGreen. Insertion site verified by PCR and sequencing.
|
|
| NK2335 |
C. elegans |
lam-2(qy20[lam-2::mNG+LoxP]) X. Show Description
Superficially wild-type. CRISPR/Cas9 insertion of mNeonGreen. Insertion site verified by PCR and sequencing. Reference: Jayadev R, et al. J Cell Biol. 2019 Aug 6. pii: jcb.201903124. doi: 10.1083/jcb.201903124.
|
|
| NK2353 |
C. elegans |
agr-1 (qy27[agr-1::mNG+loxP]) II. Show Description
Superficially wild-type. CRISPR/Cas9 insertion of mNeonGreen. Insertion site verified by PCR and sequencing.
|
|
| NK2404 |
C. elegans |
epi-1(qy31[epi-1::mNG+loxP]) IV. Show Description
Superficially wild-type. CRISPR/Cas9 insertion of mNeonGreen. Insertion site verified by PCR and sequencing.
|
|
| NK2413 |
C. elegans |
sdn-1(qy29[sdn-1::mNG+loxP]) X. Show Description
Superficially wild-type. CRISPR/Cas9 insertion of mNeonGreen. Insertion site verified by PCR and sequencing.
|
|
| NK2422 |
C. elegans |
him-4(qy33[him-4::mNG+loxP]) X. Show Description
Superficially wild-type. CRISPR/Cas9 insertion of mNeonGreen. Insertion site verified by PCR and sequencing.
|
|
| NK2425 |
C. elegans |
lam-3(qy28[lam-3::mNG+loxP]) I. Show Description
Superficially wild-type. Slow growth. CRISPR/Cas9 insertion of mNeonGreen. Insertion site verified by PCR and sequencing.
|
|
| NK2436 |
C. elegans |
pat-3(qy36[pat-3::mNG]) III. Show Description
Superficially wild-type. Reference: Jayadev R, et al. J Cell Biol. 2019 Aug 6. pii: jcb.201903124. doi: 10.1083/jcb.201903124.
|
|
| NK2442 |
C. elegans |
mig-6(qy37[mNG+loxP::mig-6]) V. Show Description
Superficially wild-type. CRISPR/Cas9 insertion of mNeonGreen. Insertion site verified by PCR and sequencing. mNeonGreen is inserted at the N-terminus right before a putative proprotein convertase cleavage site and Western analysis indicates most of the mNeonGreen is cut from the MIG-1 protein and is diffuse in the extracellular fluid. See Figure S1 in Keeley et al., Dev Cell. 2020 Jul 6;54(1):60-74.e7. doi: 10.1016/j.devcel.2020.05.022. PMID: 32585132
|
|
| NK2443 |
C. elegans |
nid-1(qy38[nid-1::mNG+loxP]) V. Show Description
Superficially wild-type. CRISPR/Cas9 insertion of mNeonGreen. Insertion site verified by PCR and sequencing.
|
|
| NK2444 |
C. elegans |
pxn-2(qy39[pxn-2::mNG+loxP]) X. Show Description
Superficially wild-type. CRISPR/Cas9 insertion of mNeonGreen. Insertion site verified by PCR and sequencing.
|
|
| NK2445 |
C. elegans |
pxn-1(qy40[pxn-1::mNG+loxP]) V. Show Description
Superficially wild-type. CRISPR/Cas9 insertion of mNeonGreen. Insertion site verified by PCR and sequencing.
|
|
| NK2446 |
C. elegans |
lam-2(qy41[lam-2::mKate2]) X. Show Description
Superficially wild-type. Reference: Jayadev R, et al. J Cell Biol. 2019 Aug 6. pii: jcb.201903124. doi: 10.1083/jcb.201903124.
|
|
| NK2456 |
C. elegans |
ddr-1(qy43[ddr-1::mNG+loxP]) X. Show Description
Superficially wild-type. CRISPR/Cas9 insertion of mNeonGreen. Insertion site verified by PCR and sequencing.
|
|
| NK2457 |
C. elegans |
ddr-2(qy44[ddr-2::mNG+loxP]) X. Show Description
Superficially wild-type. CRISPR/Cas9 insertion of mNeonGreen. Insertion site verified by PCR and sequencing.
|
|
| NK2476 |
C. elegans |
ina-1(qy46[ina-1::mKate+loxP]) III. Show Description
Superficially wild-type. CRISPR/Cas9 insertion of mKate. Insertion site verified by PCR and sequencing.
|
|
| NK2477 |
C. elegans |
ptp-3(qy47[ptp-3::mNG+loxP]) II. Show Description
Superficially wild-type. CRISPR/Cas9 insertion of mNeonGreen. Insertion site verified by PCR and sequencing.
|
|
| NK2479 |
C. elegans |
pat-2(qy49[pat-2::2xmNG]) III. Show Description
Superficially wild-type. Reference: Jayadev R, et al. J Cell Biol. 2019 Aug 6. pii: jcb.201903124. doi: 10.1083/jcb.201903124.
|
|
| NK2500 |
C. elegans |
unc-52(qy53[unc-52::mNG+loxP]) II. Show Description
Superficially wild-type. CRISPR/Cas9 insertion of mNeonGreen. Insertion site verified by PCR and sequencing.
|
|
| NK2502 |
C. elegans |
ten-1(qy56[ten-1::mNG+loxP]) III. Show Description
Superficially wild-type. CRISPR/Cas9 insertion of mNeonGreen. Insertion site verified by PCR and sequencing.
|
|
| NK2503 |
C. elegans |
rap-3(qy57[rap-3::mNG]) IV. Show Description
Superficially wild-type. Reference: Jayadev R, et al. J Cell Biol. 2019 Aug 6. pii: jcb.201903124. doi: 10.1083/jcb.201903124.
|
|
| NK2540 |
C. elegans |
fdgt-1(qy65[fgt-1::mNG +loxP]) II. Show Description
Superficially wild-type. mNG tag inserted into the endogenous fgt-1 locus. fdgt-1 formerly known as fgt-1. Reference: Garde A, et. al. Dev. Cell. 2022 Mar 28;57(6):732-749.e7. PMID: 35316617
|
|
| NK2555 |
C. elegans |
unc-52(qy75[mNG+loxP::unc-52]) II. Show Description
Superficially wild-type. CRISPR/Cas9 insertion of mNeonGreen. Insertion site verified by PCR and sequencing.
|
|
| NK2557 |
C. elegans |
mig-6(qy73[mig-6::mNG+loxP]) V. Show Description
Superficially wild-type. Specifically tags the long isoform of mig-6. CRISPR/Cas9 insertion of mNeonGreen. Insertion site verified by PCR and sequencing.
|
|
| NK2565 |
C. elegans |
pxn-2(qy76[mNG+loxP::pxn-2]) X. Show Description
Superficially wild-type. CRISPR/Cas9 insertion of mNeonGreen. Insertion site verified by PCR and sequencing.
|
|
| NK2579 |
C. elegans |
fbl-1(qy62[mNG+loxP::fbl-1]) IV. Show Description
Superficially wild-type. CRISPR/Cas9 insertion of mNeonGreen. Insertion site verified by PCR and sequencing.
|
|
| NK2580 |
C. elegans |
spon-1(qy30[spon-1::mNG+loxP]) II. Show Description
Superficially wild-type. CRISPR/Cas9 insertion of mNeonGreen. Insertion site verified by PCR and sequencing.
|
|
| NK2581 |
C. elegans |
gpn-1(qy35[gpn-1::mNG+loxP]) X. Show Description
Superficially wild-type. CRISPR/Cas9 insertion of mNeonGreen. Insertion site verified by PCR and sequencing.
|
|
| NK2582 |
C. elegans |
lon-2(qy55[lon-2::mNG+loxP]) X. Show Description
Superficially wild-type. CRISPR/Cas9 insertion of mNeonGreen. Insertion site verified by PCR and sequencing.
|
|
| NK2583 |
C. elegans |
unc-52(qy80[mNG+loxP (synthetic exon)::unc-52]) II. Show Description
Superficially wild-type. CRISPR/Cas9 insertion of mNeonGreen. Insertion site verified by PCR and sequencing.
|
|
| NK2590 |
C. elegans |
gon-1(qy45[gon-1::mNG+loxP]) IV. Show Description
Superficially wild-type. CRISPR/Cas9 insertion of mNeonGreen. Insertion site verified by PCR and sequencing.
|
|
| NK2604 |
C. elegans |
emb-9 (qy89[emb-9::mEos2+loxP]) III. Show Description
Superficially wild-type. CRISPR/Cas9 insertion of mNeonGreen. Insertion site verified by PCR and sequencing.
|
|
| NK2609 |
C.elegans |
qyIs50 V; qyIs550. Show Description
qyIs50 [cdh-3p::moeABD::mCherry + unc-119(+)] V. qyIs550 [zmp-1p::MLS::GFP + unc-119(+)]. Superficially wild-type animals expressing mitochondrial GFP and red F-actin in the anchor cell. Reference: Garde A, et. al. Dev. Cell. 2022 Mar 28;57(6):732-749.e7. PMID: 35316617
|
|
| NK2623 |
C. elegans |
ucr-2.1(qy92[ucr-2.1::mNG]) X. Show Description
mNeonGreen tag inserted into the endogenous ucr-2.1 locus (C-terminus tag). Insertion verified by PCR. Left flanking sequence: 5' TCAGAAGGAACGACTCGTTG 3' ; Right flanking sequence: 5' CGAAAGTAGAATGCTAGTCAAG 3'. sgRNA: 5' TTTATAGCTCGTCGAGATAT 3'. Superficially wild-type.
|
|
| NK2636 |
C. elegans |
fasn-1(qy98[fasn-1::mNG]) I. Show Description
fasn-1 locus endogenously tagged with mNG at the C-terminus. Superficially wild-type. Reference: Park K, et al. J Cell Biol. 2024 Oct 7;223(10):e202402035. PMID: 39007804.
|
|
| NK2637 |
C. elegans |
unc-119(ed4) III; qyIs553 Show Description
qyIs553 [lin-29p::ceGreenGlifon4000 +unc-119(+)]. Superficially wild-type strain expressing green glucose biosensor in the anchor cell. Reference: Garde A, et. al. Dev. Cell. 2022 Mar 28;57(6):732-749.e7. PMID: 35316617
|
|
| NK2721 |
C. elegans |
qySi569 I. Show Description
qySi569 [cdh-3p::fdgt-2::mNG + loxP] I. Superficially wild type animal expressing a single copy insertion of glucose transporter fdgt-2 in the anchor cell. fdgt-2 formerly known as fgt-2. Reference: Garde A, et. al. Dev. Cell. 2022 Mar 28;57(6):732-749.e7. PMID: 35316617
|
|
| NK2739 |
C. elegans |
cox-5B(qy137[cox-5B::mNG]) I. Show Description
mNeonGreen tag inserted into C-terminus of endogenous cox-5B locus. Insertion verified by PCR. Left flanking sequence: 5' TACAGCATGTGTAGACAACGAG 3' ; Right flanking sequence: 5' AAAGATGCGCACACAGACACA 3'. sgRNA: 5' TGTTTAGATGGATTCTGGGT 3'. Superficially wild-type.
|
|
| NK2743 |
C. elegans |
cox-10(qy141[cox-10::mNG]) II. Show Description
mNeonGreen tag inserted into C-terminus of endogenous mNeonGreen tag inserted into C-terminus of endogenous cox-10 locus. Insertion verified by PCR. Left flanking sequence: 5' GGCACTCACATTTTCGCGTTA 3' ; Right flanking sequence: 5' TGAAGCGCGTCTAACACGTT 3'. sgRNA: 5' GAACGGCTACAACAAAATGG 3'. Superficially wild-type.
|
|
| NK2752 |
C. elegans |
qyIs555. Show Description
qyIs555 [cdh-3p::aman-2::GFP]. Anchor cell specific expression of golgi protein aman-2. Superficially wild-type. Reference: Park K, et al. J Cell Biol. 2024 Oct 7;223(10):e202402035. PMID: 39007804.
|
|
| NK2756 |
C. elegans |
qyIs562. Show Description
qyIs562 [zmp-1p::zmp-1sp::sfGFP::KDEL]. Anchor cell specific expression of KDEL ER lumen marker. Superficially wild-type. Reference: Park K, et al. J Cell Biol. 2024 Oct 7;223(10):e202402035. PMID: 39007804.
|
|
| NK2765 |
C. elegans |
qySi120[eef-1A.1p::iATpSnFR1.0::unc-54 3'UTR] I. Show Description
Superfically wild-type strain with ubiquitous somatic expression of ATP biosensor iATPSnFR1.0 inserted into ttTi4348 mosSCI site (I:-5.32) using CRISPR/Cas9-mediated recombination. Internal iATPSnFR1.0 reverse primer: 5' CTTCATCTCGGCGACGGAGAGACGGTT 3'
|
|
| NK2864 |
C. elegans |
qySi180 I. Show Description
qySi180 [lin-29p::GFP::CAAX] I. MosSCI single copy insertion. Anchor cell specific expression of CAAX motif. Superficially wild-type. Reference: Park K, et al. J Cell Biol. 2024 Oct 7;223(10):e202402035. PMID: 39007804.
|
|
