Search Strains

More Fields See WormTagDB for other published tagged loci.
Strain Species Genotype Add
BC918 C. elegans let-63(s170) unc-22(s7)/+ + IV. Show Description
Heterozygotes are WT and segregate WT and Lethal Twitchers. Lethal mid larval. Maintain by picking WT which throw Lethal Twitchers. Hets twitch in 1% Nicotine.
BC933 C. elegans unc-22(s7) let-66(s176)/+ + IV. Show Description
Heterozygotes are WT and segregate WT and Lethal Twitchers. Lethal early larval. Heterozygotes twitch in 1% nicotine.
BC934 C. elegans let-59(s175) unc-22(s7)/+ + IV. Show Description
Heterozygotes are WT and segregate WT and dead eggs. Hets twitch in 1% nicotine. Maintain by picking Twitchers in 1% Nicotine.
BC954 C. elegans let-64(s216) unc-22(s7)/+ + IV. Show Description
Heterozygotes are WT (twitch in 1% nicotine) and segregate WT and thin, twitcher sterile adults. Pick twitchers in 1% nicotine to maintain.
BC964 C. elegans let-56(s46) unc-22(s7)/unc-5(e152) dpy-4(e1166) IV. Show Description
Heterozygotes are WT and segregate more WT, DpyUncs and Lethal Twitchers. Lethal late larval. Heterozygotes Twitch in 1% Nicotine. Pick WT to maintain.
BC965 C. elegans let-59(s49) unc-22(s7)/unc-5(e152) dpy-4(e1166) IV. Show Description
Heterozygotes are WT and segregate WT, DpyUnc and Lethal Twitchers. Lethal early larval. Hets twitch in 1% Nicotine. Pick WT to maintain.
BC966 C. elegans let-60(s59) unc-22(s7)/unc-5(e152) dpy-4(e1166) IV. Show Description
Heterozygotes are WT and segregate WT, DpyUnc, and Lethal Twitchers. Lethal mid-larval (leaky). Heterozygotes twitch in nicotine.
BC987 C. elegans unc-22(s7) let-52(s42)/+ + IV. Show Description
Heterozygotes are WT and segregate WT and Lethal Twitchers. Lethal early larval. Hets twitch in 1% Nicotine. Pick WT to maintain.
BW1747 C. elegans dpy-18(e364)/eT1 III; unc-46(e177) let-427(s1057)/eT1 V. Show Description
Heterozygotes are WT and segregate WT, Unc-36, Sterile DpyUncs and dead eggs. Maintain by picking WT.
CB2779 C. elegans let-201(e1716) unc-54(e1092)/eDf24 I. Show Description
Heterozygotes are WT. eDf24 homozygotes arrest as early larvae. eDf24 = let(e2000).
CB2780 C. elegans let-203(e1717) unc-54(e1092)/eDf24 I. Show Description
Heterozygotes are WT. eDf24 homozygotes arrest as early larvae. eDf24 = let(e2000).
CB2781 C. elegans unc-54(e1092) let-208(e1718)/eDf24 I. Show Description
Heterozygotes are WT. eDf24 homozygotes arrest as early larvae. eDf24 = let(e2000).
CB2782 C. elegans let-204(e1719) unc-54(e1092)/eDf24 I. Show Description
Heterozygotes are WT. eDf24 homozygotes arrest as early larvae. eDf24 = let(e2000).
CB2784 C. elegans let-202(e1720) unc-54(e1092)/eDf24 I. Show Description
Heterozygotes are WT. eDf24 homozygotes arrest as early larvae. eDf24 = let(e2000).
CB2785 C. elegans let-206(e1721) unc-54(e1092)/eDf24 I. Show Description
Heterozygotes are WT. eDf24 homozygotes arrest as early larvae. eDf24 = let(e2000).
CB2786 C. elegans let-205(e1722) unc-54(e1092)/eDf24 I. Show Description
Heterozygotes are WT. eDf24 homozygotes arrest as early larvae. eDf24 = let(e2000).
CB2787 C. elegans let-207(e1723) unc-54(e1092)/eDf24 I. Show Description
Heterozygotes are WT. eDf24 homozygotes arrest as early larvae. eDf24 = let(e2000).
CB3313 C. elegans ect-2(e1778)/dpy-10(e128) II. Show Description
Poorly balanced. Hets are WT and segregate WT, Dpys and ect-2 homozygotes. ect-2 homozygotes are sterile Uncs which reach adulthood, sometimes giving polynucleate oocytes. ect-2 pka let-21.
CB4883 C. elegans let-551(e2517)/dpy-21(e428) rol-9(sc148) V. Show Description
Heterozygotes are WT and segregate WT, Lethals (L2/L3 arrest at 20C, some survive to sterile adults at 15C), and DpyRol. Not balanced well: get recombinants. Must maintain by picking hets at each generation and check for proper segregants in F1.
CB5009 C. elegans let-552(e2542)/dpy-25(e817) II. Show Description
At 20C or 25C heterozygotes are semi-Dpy and segregate semi-Dpys (heterozygotes), Dpys (dpy-25/dpy-25) and animals which arrest as Dpyish young larvae (let-552/let-552). Maintain by picking semi-Dpy. At 15C it is difficult to distinguish between let-552 homozygotes and dpy-25 homozygotes (e817 is inviable at 15C).
CB5378 C. elegans unc-42(e270) let-560(e2658) V/nT1 (IV;V). Show Description
let-560(e2658) was a spontaneous mutation in strain DH424. let-560 homozygotes are late embryonic lethal. Strain segregates WT, Vul and dead eggs.
CE1857 C. elegans ect-2(e1778)/unc-4(e120) sqt-1(sc13) II. Show Description
Heterozygotes are WT and segregate WT, Roller Uncs, and ect-2 homozygotes (sterile Uncs which reach adulthood, sometimes giving polynucleate oocytes). ect-2 pka let-21. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
CF367 C. elegans mig-14(mu71) II. Show Description
QL descendants anterior, QR descendants slightly posterior to WT. HSN posterior (50%), BDU posterior (50%), DTCs make extra turns. Mild Egl. Male Mating: ME2. mig-14, mom-3, pvl-2, and let-553 are the same gene.
CGC100 C. elegans lin-4(umn12[lin-4p+SL1(long)::mScarlet-I + Lox511I sqt-1(d) hsp::CRE hygR Lox511I])/mIn1[dpy-10(e128) umnIs33] II. Show Description
umnIs33 [myo-2p::GFP + NeoR, II: 11755713 (intergenic)] II. lin-4 deletion allele in which lin-4 pre-miRNA (II, lin4:5902254..5902347) was replaced by mScarlet with SL1 (long sequence). Heterozygotes are GFP+ mScarlet+ Rollers, and segregate GFP+ mScarlet+ Rollers, non-GFP mScarlet+ lin-4 homozygotes, and Dpy GFP+ mIn1 homozygotes. Maintain by picking wild-type GFP+ mScarlet+ and check for correct segregation of progeny to maintain. Generated in parental strain N2. [NOTE: Low levels of Cre activity can lead to excision of the SEC, causing the strain to lose the Roll phentoype. Pick Rollers to retain full transgene cassette.]
CGC101 C. elegans lin-4(umn13[lin-4p+SL1(long)+Kozac::mScarlet-I + Lox511I sqt-1(d) hsp::CRE hygR Lox511I])/mIn1[dpy-10(e128) umnIs33] II. Show Description
umnIs33 [myo-2p::GFP + NeoR, II: 11755713 (intergenic)] II. lin-4 deletion allele in which lin-4 pre-miRNA (II, lin4:5902254..5902347) was replaced by mScarlet with SL1 (long sequence) and Kozac sequence. Heterozygotes are GFP+ mScarlet+ Rollers, and segregate GFP+ mScarlet+ Rollers, non-GFP mScarlet+ lin-4 homozygotes, and Dpy GFP+ mIn1 homozygotes. Maintain by picking wild-type GFP+ mScarlet+ and check for correct segregation of progeny to maintain. Generated in parental strain N2. [NOTE: Low levels of Cre activity can lead to excision of the SEC, causing the strain to lose the Roll phentoype. Pick Rollers to retain full transgene cassette.]
CGC106 C. elegans lin-4(umn17[lin-4p::mScarlet-I::Lox511I::let-858 3' UTR]) II/mIn1[dpy-10(e128) umnIs33] II. Show Description
umnIs33 [myo-2p::GFP + NeoR, II: 11755713 (intergenic)] II. Derived by CRE-meditated excision of SEC in parental strain CGC98. lin-4 deletion allele in which lin-4 pre-miRNA (II, lin4:5902254..5902347) was replaced by mScarlet. Heterozygotes are GFP+ mScarlet+, and segregate GFP+ mScarlet+ heterozygotes, non-GFP mScarlet+ lin-4 homozygotes, and Dpy GFP+ mIn1 homozygotes. Maintain by picking wild-type GFP+ mScarlet+ and check for correct segregation of progeny to maintain.
CGC107 C. elegans lin-4(umn18[lin-4p::SL1(short)::mScarlet-I::Lox511I::let-858 3' UTR]) /mIn1[dpy-10(e128) umnIs33] II. Show Description
umnIs33 [myo-2p::GFP + NeoR, II: 11755713 (intergenic)] II. Derived by CRE-meditated excision of SEC in parental strain CGC99, leaving myo-2p::wrmScarlet. lin-4 deletion allele in which lin-4 pre-miRNA (II, lin4:5902254..5902347) was replaced by mScarlet with SL1 (short sequence). Heterozygotes are GFP+ mScarlet+, and segregate GFP+ mScarlet+ heterozygotes, non-GFP mScarlet+ lin-4 homozygotes, and Dpy GFP+ mIn1 homozygotes. Maintain by picking wild-type GFP+ mScarlet+ and check for correct segregation of progeny to maintain.
CGC108 C. elegans lin-4(umn19[lin-4p::SL1long::mScarlet-I::Lox511I::let-858 3'UTR]) II/mIn1[dpy-10(e128) umnIs33] II. Show Description
umnIs33 [myo-2p::GFP + NeoR, II: 11755713 (intergenic)] II. Derived by CRE-meditated excision of SEC in parental strain CGC100. lin-4 deletion allele in which lin-4 pre-miRNA (II, lin4:5902254..5902347) was replaced by mScarlet with SL1 (long sequence). Heterozygotes are GFP+ mScarlet+, and segregate GFP+ mScarlet+ homozygotes, non-GFP mScarlet+ lin-4 homozygotes, and Dpy GFP+ mIn1 homozygotes. Maintain by picking wild-type GFP+ mScarlet+ and check for correct segregation of progeny to maintain.
CGC109 C. elegans lin-4(umn20[lin-4p::SL1long::Kozak::mScarlet-I::Lox511I::let-858 3' UTR]) II/mIn1[dpy-10(e128) umnIs33] II. Show Description
umnIs33 [myo-2p::GFP + NeoR, II: 11755713 (intergenic)] II. Derived by CRE-meditated excision of SEC in parental strain CGC101. lin-4 deletion allele in which lin-4 pre-miRNA (II, lin4:5902254..5902347) was replaced by mScarlet with SL1 (long sequence) and Kozac sequence. Heterozygotes are GFP+ mScarlet+, and segregate GFP+ mScarlet+ heterozygotes, non-GFP mScarlet+ lin-4 homozygotes, and Dpy GFP+ mIn1 homozygotes. Maintain by picking wild-type GFP+ mScarlet+ and check for correct segregation of progeny to maintain.
CGC116 C. elegans lin-4(umn27[lin-4p+SL1(short)+Kozak::mScarlet-I + Lox511I sqt-1(d) hsp::CRE hygR Lox511I])/mIn1 [dpy-10(e128) umnIs33] II. Show Description
umnIs33 [myo-2p::GFP + NeoR, II: 11755713 (intergenic)] II. Rollers. lin-4 pre-miRNA deletion strain deletion allele in which lin-4 pre-miRNA was replaced by myo-2p::wrmScarlet; includes SL1(short) and Kozak sequence upstream of mScarlet. Heterozygotes are Rol GFP+ mScarlet+ heterozygotes, non-GFP Scarlet+ lin-4 homozygotes, and Dpy GFP+ non-Scarlet mIn1 homozygotes. Maintain by picking Rol GFP+ mScarlet+ and check for correct segregation of progeny to maintain. Generated in parental strain N2. [NOTE: Low levels of Cre activity can lead to excision of the SEC, causing the strain to lose the Roll phentoype. Pick Rollers to retain full transgene cassette.]
CGC117 C. elegans lin-4(umn28[lin-4p+SL1(short)+Kozak::mScarlet-I::Lox511I::let-858 3' UTR])/mIn1 [dpy-10(e128) umnIs33] II. Show Description
umnIs33 [myo-2p::GFP + NeoR, II: 11755713 (intergenic)] II. lin-4 pre-miRNA deletion strain deletion allele in which lin-4 pre-miRNA was replaced by myo-2p::wrmScarlet; includes SL1(short) and Kozak sequence upstream of mScarlet. Heterozygotes are GFP+ mScarlet+, and segregate GFP+ mScarlet+ heterozygotes, non-GFP mScarlet+ lin-4 homozygotes, and Dpy GFP+ mIn1 homozygotes. Maintain by picking wild-type GFP+ mScarlet+ and check for correct segregation of progeny to maintain. Derived by CRE-meditated excision of SEC in parental strain CGC116, leaving lin-4p::mScarlet.
CGC118 C. elegans lin-4(umn29[lin-4p+SL1long+Kozak::egl-13-NLS::mScarlet-I::c-myc-NLS + Lox511I sqt-1(d) hsp::CRE hygR Lox511I])/mIn1[dpy-10(e128) umnIs33] II. Show Description
umnIs33 [myo-2p::GFP + NeoR, II: 11755713 (intergenic)] II. lin-4 pre-miRNA deletion strain deletion allele in which lin-4 pre-miRNA was replaced by myo-2p::wrmScarlet; includes SL1(long) and Kozak sequence upstream of mScarlet. Heterozygotes are Rol GFP+ mScarlet+, and segregate GFP+ mScarlet+ heterozygotes, non-GFP mScarlet+ lin-4 homozygotes, and Dpy GFP+ mIn1 homozygotes. Maintain by picking Rol GFP+ mScarlet+ and check for correct segregation of progeny to maintain. Derived by CRE-meditated excision of SEC in parental strain CGC118, leaving lin-4p::mScarlet.
CGC119 C. elegans lin-4(umn30[lin-4p+SL1long+Kozak::egl-13-NLS::mScarlet-I::c-myc-NLS::Lox511I::let-858 3' UTR])/mIn1[dpy-10(e128) umnIs33] II. Show Description
umnIs33 [myo-2p::GFP + NeoR, II: 11755713 (intergenic)] II. lin-4 pre-miRNA deletion strain deletion allele in which lin-4 pre-miRNA was replaced by myo-2p::wrmScarlet; includes SL1(long) and Kozak sequence upstream of mScarlet. Heterozygotes are GFP+ mScarlet+, and segregate GFP+ mScarlet+ heterozygotes, non-GFP mScarlet+ lin-4 homozygotes, and Dpy GFP+ mIn1 homozygotes. Maintain by picking wild-type GFP+ mScarlet+ and check for correct segregation of progeny to maintain. Derived by CRE-meditated excision of SEC in parental strain CGC118, leaving lin-4p::mScarlet.
CGC124 C. elegans mir-61(umn35[mir-61p::egl-13-NLS::mScarlet-I::SV40NLS::Lox511I::let-858 3'UTR]) V. Show Description
mir-61 pre-miRNA deletion strain deletion allele in which mir-61 pre-miRNA was replaced by mScarlet. Generated in parental strain N2.
CGC125 C. elegans mir-61(umn36[mir-61p::egl-13-NLS::mScarlet-I::SV40NLS::Lox511I::let-858 3'UTR]) V. Show Description
mir-61 pre-miRNA deletion strain deletion allele in which mir-61 pre-miRNA was replaced by mScarlet. Generated in parental strain N2.
CGC126 C. elegans mir-61(umn37[mir-61p+SL1::egl-13-NLS::mScarlet-I::SV40NLS::Lox511I::let-858 3'UTR]) V. Show Description
mir-61 pre-miRNA deletion strain deletion allele in which mir-61 pre-miRNA was replaced by mScarlet. Generated in parental strain N2.
CGC127 C. elegans mir-61(umn38[mir-61p+SL1::egl-13-NLS::mScarlet-I::SV40NLS::Lox511I::let-858 3'UTR]) V. Show Description
mir-61 pre-miRNA deletion strain deletion allele in which mir-61 pre-miRNA was replaced by mScarlet. Generated in parental strain N2.
CGC128 C. elegans +/hT2 [umnIs15] I; dcr-1(pk1351)/hT2 [bli-4(e937) let-?(h661)] III. Show Description
umnIs15 [myo-2p::GFP + NeoR, III: 9421936 (intergenic)] I. Heterozygotes are WT GFP+ and segregate WT GFP+, dcr-1 homozygotes (protruding vulva, sterile/egl, rupture at vulva), lethal GFP+ hT2 homozygotes (arrest stage unknown) and dead eggs (aneuploids). Will throw an occasional GFP+ Pvul. Pick WT GFP+ and check for correct segregation of progeny to maintain. Derived from parental strains CGC26 and NL687. [NOTE: 3/1995: Apparently the lethal mutation is closely linked but not within the balanced region of hT2. It can occasionally recombine away so that the strain will segregate Bli-4 hT2 homozygotes. (Mark Edgley)]
CGC129 C. elegans mir-61(umn39[mir-61p+SL1+Kozak::egl-13-NLS::mScarlet-I::SV40NLS::Lox511I::let-858 3'UTR]) V. Show Description
mir-61 pre-miRNA deletion strain deletion allele in which mir-61 pre-miRNA was replaced by mScarlet. Generated in parental strain N2.
CGC130 C. elegans mir-61(umn40[mir-61p+SL1+Kozak::egl-13-NLS::mScarlet-I::SV40NLS::Lox511I::let-858 3'UTR]) V. Show Description
mir-61 pre-miRNA deletion strain deletion allele in which mir-61 pre-miRNA was replaced by mScarlet. Generated in parental strain N2.
CGC133 C. elegans lin-4(umn43[lin-4p+SL1sh::egl-13-NLS::mScarlet-I::c-myc-NLS::Lox511I::let-858 3' UTR]) II. Show Description
nuclear mScarlet replacement of lin-4 pre-miRNA. Includes SL1 sequence upstream of mScarlet
CGC134 C. elegans lin-4(umn44[lin-4p+SL1sh+Kozak:egl-13-NLS::mScarlet-I::c-myc-NLS::linker::mODC(422-461)(E428A/E430A/E431A)::Lox511I::let-858 3' UTR]) II. Show Description
Nuclear-localized mScarlet replacement of lin-4 pre-miRNA. mScarlet is tagged with the worm codon-optomized mouse ornithine decarboxylase PEST 422-461 with the following mutations E428A/E430A/E431A. Includes SL1 and kozak sequence upstream of mScarlet.
CGC135 C. elegans let-7(umn45[let-7p::egl-13-NLS::mScarlet-I::c-myc-NLS::linker::mODC(422-461)(E428A/E430A/E431A)::let-858 3' UTR])/tmC24 [F23D12.4(tmIs1240) unc-9(tm9719)] X. Show Description
tmIs1240 [myo-2p::venus, X: F23D12.4] X. Nuclear mScarlet-I fused to a PEST was inserted in place of the endogenous let-7 pre-miRNA via CRISPR/CAS9. Heterozygotes are wild-type GFP+ mScarlet+ and segregate wild-type GFP+ mScarlet+ heterozygotes, mScarlet+ non-GFP dead larvae (umn45 homozygotes) and Mec(Unc) non-mScarlet GFP+ (tmC24 homozygotes). Maintain by picking wild-type GFP+ mScarlet+. Left Flanking: GCAAGCAGGCGATTGGTGGACGGTC, Right Flanking: AGCTGCGTCGTCTTGCTCTCACAAc. sgRNA: AAAATTGCATAGTTCACCGG.
CGC136 C. elegans mir-84(umn46[mir-84p+SL1::egl-13-NLS::mScarlet-I::c-myc-NLS::linker::mODC(422-461)(E428A/E430A/E431A)::let-858 3' UTR]) X. Show Description
Nuclear mScarlet-I fused to a PEST was inserted in place of the endogenous mir-84 pre-miRNA via CRISPR/CAS9. Left Flanking: GTTGAGACATGTATATGTTTTTGTT, Right Flanking: GCTACTATTCATCATACGTCTGCCT. sgRNA: ATTCATCATACGTCTGCCTG.
CGC137 C. elegans mir-241(umn47[mir-241p+SL1::egl-13-NLS::mScarlet-I::c-myc-NLS::linker::mODC(422-461)(E428A/E430A/E431A)::let-858 3' UTR]) V. Show Description
Nuclear mScarlet-I fused to a PEST was inserted in place of the endogenous mir-241 pre-miRNA via CRISPR/CAS9. Left Flanking: CTATTTTTTTCACTTGGATTAGGGG, Right Flanking: GGGATGCTCTTTTTGTACCAAACCG. sgRNA: CCTCAACTTTGACACCCCCG.
CGC152 C. elegans mir-48(umn59[mir-48p+SL1::EGL-13NLS::mScarlet-I::cMycNLS::Lox511I::let-858 3'UTR]) V. Show Description
Nuclear mScarlet-I was inserted in place of the endogenous mir-48 pre-miRNA via CRISPR/CAS9.  Left Flanking: CACAGGTAAGTCAATTAACCAATTG, Right Flanking: TTATTATTATGTTTCATTCAATAAC. sgRNA: GGGAATGCGAGCTAGGCTGG.
CGC153 C. elegans mir-48(umn60[mir-48p+SL1::EGL-13NLS::mScarlet-I::cMycNLS::linker::mODC(422-461)(E428A/E430A/E431A):: lox511I::let-858 3'UTR]) V. Show Description
Nuclear mScarlet-I was inserted in place of the endogenous mir-48 pre-miRNA via CRISPR/CAS9.  Left Flanking: CACAGGTAAGTCAATTAACCAATTG, Right Flanking: TTATTATTATGTTTCATTCAATAAC. sgRNA: GGGAATGCGAGCTAGGCTGG.
CGC155 C. elegans mir-61&mir-250(umn62[mir-61p::SL1::lox2272::EGL-13NLS::mScarlet-I::SV40NLS:: lox511I sqt-1(d) hsp::CRE HygR lox511I::let-858 3'UTR::lox2722]) V. Show Description
mScarlet replacement of mir-61 and mir-250 pre-miRNAs.
CGC156 C. elegans mir-61&mir-250(umn63[mir-61p::SL1::lox2272::EGL-13NLS::mScarlet-I::SV40NLS::Lox511I::let-858 3'UTR::lox2722]) V. Show Description
mScarlet replacement of mir-61 and mir-250 pre-miRNAs. SEC has been removed.
CGC157 C. elegans mir-61&mir-250(umn64[mir-61p::SL1::lox2272]) V. Show Description
mScarlet replacement of mir-61 and mir-250 pre-miRNAs. SEC and mScarlet-I have been removed.