Search Strains

Heterozygotes are WT and segregate WT and Lethal Twitchers. Lethal mid larval. Maintain by picking WT which throw Lethal Twitchers. Hets twitch in 1% Nicotine.

Heterozygotes are WT and segregate WT and Lethal Twitchers. Lethal early larval. Heterozygotes twitch in 1% nicotine.

Heterozygotes are WT and segregate WT and dead eggs. Hets twitch in 1% nicotine. Maintain by picking Twitchers in 1% Nicotine.

Heterozygotes are WT (twitch in 1% nicotine) and segregate WT and thin, twitcher sterile adults. Pick twitchers in 1% nicotine to maintain.

Heterozygotes are WT and segregate more WT, DpyUncs and Lethal Twitchers. Lethal late larval. Heterozygotes Twitch in 1% Nicotine. Pick WT to maintain.

Heterozygotes are WT and segregate WT, DpyUnc and Lethal Twitchers. Lethal early larval. Hets twitch in 1% Nicotine. Pick WT to maintain.

Heterozygotes are WT and segregate WT, DpyUnc, and Lethal Twitchers. Lethal mid-larval (leaky). Heterozygotes twitch in nicotine.

Heterozygotes are WT and segregate WT and Lethal Twitchers. Lethal early larval. Hets twitch in 1% Nicotine. Pick WT to maintain.

Heterozygotes are WT and segregate WT, Unc-36, Sterile DpyUncs and dead eggs. Maintain by picking WT.

Heterozygotes are WT. eDf24 homozygotes arrest as early larvae. eDf24 = let(e2000).

Heterozygotes are WT. eDf24 homozygotes arrest as early larvae. eDf24 = let(e2000).

Heterozygotes are WT. eDf24 homozygotes arrest as early larvae. eDf24 = let(e2000).

Heterozygotes are WT. eDf24 homozygotes arrest as early larvae. eDf24 = let(e2000).

Heterozygotes are WT. eDf24 homozygotes arrest as early larvae. eDf24 = let(e2000).

Heterozygotes are WT. eDf24 homozygotes arrest as early larvae. eDf24 = let(e2000).

Heterozygotes are WT. eDf24 homozygotes arrest as early larvae. eDf24 = let(e2000).

Heterozygotes are WT. eDf24 homozygotes arrest as early larvae. eDf24 = let(e2000).

Poorly balanced. Hets are WT and segregate WT, Dpys and ect-2 homozygotes. ect-2 homozygotes are sterile Uncs which reach adulthood, sometimes giving polynucleate oocytes. ect-2 pka let-21.

Heterozygotes are WT and segregate WT, Lethals (L2/L3 arrest at 20C, some survive to sterile adults at 15C), and DpyRol. Not balanced well: get recombinants. Must maintain by picking hets at each generation and check for proper segregants in F1.

At 20C or 25C heterozygotes are semi-Dpy and segregate semi-Dpys (heterozygotes), Dpys (dpy-25/dpy-25) and animals which arrest as Dpyish young larvae (let-552/let-552). Maintain by picking semi-Dpy. At 15C it is difficult to distinguish between let-552 homozygotes and dpy-25 homozygotes (e817 is inviable at 15C).

let-560(e2658) was a spontaneous mutation in strain DH424. let-560 homozygotes are late embryonic lethal. Strain segregates WT, Vul and dead eggs.

Heterozygotes are WT and segregate WT, Roller Uncs, and ect-2 homozygotes (sterile Uncs which reach adulthood, sometimes giving polynucleate oocytes). ect-2 pka let-21. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.

QL descendants anterior, QR descendants slightly posterior to WT. HSN posterior (50%), BDU posterior (50%), DTCs make extra turns. Mild Egl. Male Mating: ME2. mig-14, mom-3, pvl-2, and let-553 are the same gene.

umnIs33 [myo-2p::GFP + NeoR, II: 11755713 (intergenic)] II. lin-4 deletion allele in which lin-4 pre-miRNA (II, lin4:5902254..5902347) was replaced by mScarlet with SL1 (long sequence). Heterozygotes are GFP+ mScarlet+ Rollers, and segregate GFP+ mScarlet+ Rollers, non-GFP mScarlet+ lin-4 homozygotes, and Dpy GFP+ mIn1 homozygotes. Maintain by picking wild-type GFP+ mScarlet+ and check for correct segregation of progeny to maintain. Generated in parental strain N2. [NOTE: Low levels of Cre activity can lead to excision of the SEC, causing the strain to lose the Roll phentoype. Pick Rollers to retain full transgene cassette.]

umnIs33 [myo-2p::GFP + NeoR, II: 11755713 (intergenic)] II. lin-4 deletion allele in which lin-4 pre-miRNA (II, lin4:5902254..5902347) was replaced by mScarlet with SL1 (long sequence) and Kozac sequence. Heterozygotes are GFP+ mScarlet+ Rollers, and segregate GFP+ mScarlet+ Rollers, non-GFP mScarlet+ lin-4 homozygotes, and Dpy GFP+ mIn1 homozygotes. Maintain by picking wild-type GFP+ mScarlet+ and check for correct segregation of progeny to maintain. Generated in parental strain N2. [NOTE: Low levels of Cre activity can lead to excision of the SEC, causing the strain to lose the Roll phentoype. Pick Rollers to retain full transgene cassette.]

umnIs33 [myo-2p::GFP + NeoR, II: 11755713 (intergenic)] II. Derived by CRE-meditated excision of SEC in parental strain CGC98. lin-4 deletion allele in which lin-4 pre-miRNA (II, lin4:5902254..5902347) was replaced by mScarlet. Heterozygotes are GFP+ mScarlet+, and segregate GFP+ mScarlet+ heterozygotes, non-GFP mScarlet+ lin-4 homozygotes, and Dpy GFP+ mIn1 homozygotes. Maintain by picking wild-type GFP+ mScarlet+ and check for correct segregation of progeny to maintain.

umnIs33 [myo-2p::GFP + NeoR, II: 11755713 (intergenic)] II. Derived by CRE-meditated excision of SEC in parental strain CGC99, leaving myo-2p::wrmScarlet. lin-4 deletion allele in which lin-4 pre-miRNA (II, lin4:5902254..5902347) was replaced by mScarlet with SL1 (short sequence). Heterozygotes are GFP+ mScarlet+, and segregate GFP+ mScarlet+ heterozygotes, non-GFP mScarlet+ lin-4 homozygotes, and Dpy GFP+ mIn1 homozygotes. Maintain by picking wild-type GFP+ mScarlet+ and check for correct segregation of progeny to maintain.

umnIs33 [myo-2p::GFP + NeoR, II: 11755713 (intergenic)] II. Derived by CRE-meditated excision of SEC in parental strain CGC100. lin-4 deletion allele in which lin-4 pre-miRNA (II, lin4:5902254..5902347) was replaced by mScarlet with SL1 (long sequence). Heterozygotes are GFP+ mScarlet+, and segregate GFP+ mScarlet+ homozygotes, non-GFP mScarlet+ lin-4 homozygotes, and Dpy GFP+ mIn1 homozygotes. Maintain by picking wild-type GFP+ mScarlet+ and check for correct segregation of progeny to maintain.

umnIs33 [myo-2p::GFP + NeoR, II: 11755713 (intergenic)] II. Derived by CRE-meditated excision of SEC in parental strain CGC101. lin-4 deletion allele in which lin-4 pre-miRNA (II, lin4:5902254..5902347) was replaced by mScarlet with SL1 (long sequence) and Kozac sequence. Heterozygotes are GFP+ mScarlet+, and segregate GFP+ mScarlet+ heterozygotes, non-GFP mScarlet+ lin-4 homozygotes, and Dpy GFP+ mIn1 homozygotes. Maintain by picking wild-type GFP+ mScarlet+ and check for correct segregation of progeny to maintain.

umnIs33 [myo-2p::GFP + NeoR, II: 11755713 (intergenic)] II. Rollers. lin-4 pre-miRNA deletion strain deletion allele in which lin-4 pre-miRNA was replaced by myo-2p::wrmScarlet; includes SL1(short) and Kozak sequence upstream of mScarlet. Heterozygotes are Rol GFP+ mScarlet+ heterozygotes, non-GFP Scarlet+ lin-4 homozygotes, and Dpy GFP+ non-Scarlet mIn1 homozygotes. Maintain by picking Rol GFP+ mScarlet+ and check for correct segregation of progeny to maintain. Generated in parental strain N2. [NOTE: Low levels of Cre activity can lead to excision of the SEC, causing the strain to lose the Roll phentoype. Pick Rollers to retain full transgene cassette.]

umnIs33 [myo-2p::GFP + NeoR, II: 11755713 (intergenic)] II. lin-4 pre-miRNA deletion strain deletion allele in which lin-4 pre-miRNA was replaced by myo-2p::wrmScarlet; includes SL1(short) and Kozak sequence upstream of mScarlet. Heterozygotes are GFP+ mScarlet+, and segregate GFP+ mScarlet+ heterozygotes, non-GFP mScarlet+ lin-4 homozygotes, and Dpy GFP+ mIn1 homozygotes. Maintain by picking wild-type GFP+ mScarlet+ and check for correct segregation of progeny to maintain. Derived by CRE-meditated excision of SEC in parental strain CGC116, leaving lin-4p::mScarlet.

umnIs33 [myo-2p::GFP + NeoR, II: 11755713 (intergenic)] II. lin-4 pre-miRNA deletion strain deletion allele in which lin-4 pre-miRNA was replaced by myo-2p::wrmScarlet; includes SL1(long) and Kozak sequence upstream of mScarlet. Heterozygotes are Rol GFP+ mScarlet+, and segregate GFP+ mScarlet+ heterozygotes, non-GFP mScarlet+ lin-4 homozygotes, and Dpy GFP+ mIn1 homozygotes. Maintain by picking Rol GFP+ mScarlet+ and check for correct segregation of progeny to maintain. Derived by CRE-meditated excision of SEC in parental strain CGC118, leaving lin-4p::mScarlet.

umnIs33 [myo-2p::GFP + NeoR, II: 11755713 (intergenic)] II. lin-4 pre-miRNA deletion strain deletion allele in which lin-4 pre-miRNA was replaced by myo-2p::wrmScarlet; includes SL1(long) and Kozak sequence upstream of mScarlet. Heterozygotes are GFP+ mScarlet+, and segregate GFP+ mScarlet+ heterozygotes, non-GFP mScarlet+ lin-4 homozygotes, and Dpy GFP+ mIn1 homozygotes. Maintain by picking wild-type GFP+ mScarlet+ and check for correct segregation of progeny to maintain. Derived by CRE-meditated excision of SEC in parental strain CGC118, leaving lin-4p::mScarlet.

mir-61 pre-miRNA deletion strain deletion allele in which mir-61 pre-miRNA was replaced by mScarlet. Generated in parental strain N2.

mir-61 pre-miRNA deletion strain deletion allele in which mir-61 pre-miRNA was replaced by mScarlet. Generated in parental strain N2.

mir-61 pre-miRNA deletion strain deletion allele in which mir-61 pre-miRNA was replaced by mScarlet. Generated in parental strain N2.

mir-61 pre-miRNA deletion strain deletion allele in which mir-61 pre-miRNA was replaced by mScarlet. Generated in parental strain N2.

umnIs15 [myo-2p::GFP + NeoR, III: 9421936 (intergenic)] I. Heterozygotes are WT GFP+ and segregate WT GFP+, dcr-1 homozygotes (protruding vulva, sterile/egl, rupture at vulva), lethal GFP+ hT2 homozygotes (arrest stage unknown) and dead eggs (aneuploids). Will throw an occasional GFP+ Pvul. Pick WT GFP+ and check for correct segregation of progeny to maintain. Derived from parental strains CGC26 and NL687. [NOTE: 3/1995: Apparently the lethal mutation is closely linked but not within the balanced region of hT2. It can occasionally recombine away so that the strain will segregate Bli-4 hT2 homozygotes. (Mark Edgley)]

mir-61 pre-miRNA deletion strain deletion allele in which mir-61 pre-miRNA was replaced by mScarlet. Generated in parental strain N2.

mir-61 pre-miRNA deletion strain deletion allele in which mir-61 pre-miRNA was replaced by mScarlet. Generated in parental strain N2.

nuclear mScarlet replacement of lin-4 pre-miRNA. Includes SL1 sequence upstream of mScarlet

Nuclear-localized mScarlet replacement of lin-4 pre-miRNA. mScarlet is tagged with the worm codon-optomized mouse ornithine decarboxylase PEST 422-461 with the following mutations E428A/E430A/E431A. Includes SL1 and kozak sequence upstream of mScarlet.

tmIs1240 [myo-2p::venus, X: F23D12.4] X. Nuclear mScarlet-I fused to a PEST was inserted in place of the endogenous let-7 pre-miRNA via CRISPR/CAS9. Heterozygotes are wild-type GFP+ mScarlet+ and segregate wild-type GFP+ mScarlet+ heterozygotes, mScarlet+ non-GFP dead larvae (umn45 homozygotes) and Mec(Unc) non-mScarlet GFP+ (tmC24 homozygotes). Maintain by picking wild-type GFP+ mScarlet+. Left Flanking: GCAAGCAGGCGATTGGTGGACGGTC, Right Flanking: AGCTGCGTCGTCTTGCTCTCACAAc. sgRNA: AAAATTGCATAGTTCACCGG.

Nuclear mScarlet-I fused to a PEST was inserted in place of the endogenous mir-84 pre-miRNA via CRISPR/CAS9. Left Flanking: GTTGAGACATGTATATGTTTTTGTT, Right Flanking: GCTACTATTCATCATACGTCTGCCT. sgRNA: ATTCATCATACGTCTGCCTG.

Nuclear mScarlet-I fused to a PEST was inserted in place of the endogenous mir-241 pre-miRNA via CRISPR/CAS9. Left Flanking: CTATTTTTTTCACTTGGATTAGGGG, Right Flanking: GGGATGCTCTTTTTGTACCAAACCG. sgRNA: CCTCAACTTTGACACCCCCG.

Nuclear mScarlet-I was inserted in place of the endogenous mir-48 pre-miRNA via CRISPR/CAS9.  Left Flanking: CACAGGTAAGTCAATTAACCAATTG, Right Flanking: TTATTATTATGTTTCATTCAATAAC. sgRNA: GGGAATGCGAGCTAGGCTGG.

Nuclear mScarlet-I was inserted in place of the endogenous mir-48 pre-miRNA via CRISPR/CAS9.  Left Flanking: CACAGGTAAGTCAATTAACCAATTG, Right Flanking: TTATTATTATGTTTCATTCAATAAC. sgRNA: GGGAATGCGAGCTAGGCTGG.

mScarlet replacement of mir-61 and mir-250 pre-miRNAs.

mScarlet replacement of mir-61 and mir-250 pre-miRNAs. SEC has been removed.

mScarlet replacement of mir-61 and mir-250 pre-miRNAs. SEC and mScarlet-I have been removed.