| CB1092 |
C. elegans |
unc-54(e1092) I. Show Description
Paralyzed Unc. Null allele. |
|
| CB2779 |
C. elegans |
let-201(e1716) unc-54(e1092)/eDf24 I. Show Description
Heterozygotes are WT. eDf24 homozygotes arrest as early larvae. eDf24 = let(e2000). |
|
| CB2780 |
C. elegans |
let-203(e1717) unc-54(e1092)/eDf24 I. Show Description
Heterozygotes are WT. eDf24 homozygotes arrest as early larvae. eDf24 = let(e2000). |
|
| CB2781 |
C. elegans |
unc-54(e1092) let-208(e1718)/eDf24 I. Show Description
Heterozygotes are WT. eDf24 homozygotes arrest as early larvae. eDf24 = let(e2000). |
|
| CB2782 |
C. elegans |
let-204(e1719) unc-54(e1092)/eDf24 I. Show Description
Heterozygotes are WT. eDf24 homozygotes arrest as early larvae. eDf24 = let(e2000). |
|
| CB2784 |
C. elegans |
let-202(e1720) unc-54(e1092)/eDf24 I. Show Description
Heterozygotes are WT. eDf24 homozygotes arrest as early larvae. eDf24 = let(e2000). |
|
| CB2785 |
C. elegans |
let-206(e1721) unc-54(e1092)/eDf24 I. Show Description
Heterozygotes are WT. eDf24 homozygotes arrest as early larvae. eDf24 = let(e2000). |
|
| CB2786 |
C. elegans |
let-205(e1722) unc-54(e1092)/eDf24 I. Show Description
Heterozygotes are WT. eDf24 homozygotes arrest as early larvae. eDf24 = let(e2000). |
|
| CB2787 |
C. elegans |
let-207(e1723) unc-54(e1092)/eDf24 I. Show Description
Heterozygotes are WT. eDf24 homozygotes arrest as early larvae. eDf24 = let(e2000). |
|
| MT3778 |
C. elegans |
ced-1(e1735) unc-54(e1092) I. Show Description
Unc. Abnormal cell death. |
|
| MT6183 |
C. elegans |
bli-3(e767) unc-54(e1092) I. Show Description
Mapping strain. |
|
| RG3592 |
C. elegans |
tpxl-1(ve1092[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/hT1 [umnIs58] I; +/hT1 [unc-42(e270)] V. Show Description
umnIs58 [myo-2p::mKate2 + NeoR, V: 1005689 (intergenic)] V. Sterile. Deletion of 1411 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, Sterile GFP+ non-mKate2 (ve1092 homozygotes), non-GFP mKate2+ arrested larvae (hT1 homozygotes), and dead eggs (aneuploids). Maintain by picking wild-type GFP+ and mKate2+. Left flanking Sequence: GTGAAGTCCTCGTTGGCGTAGCAGTAACCT; Right flanking sequence: CTGCTGAAGAAATTCTCATCGAATTCCTGA. tpxl-1 sgRNA #1: CAACAGACTTGCCACACCAA; tpxl-1 sgRNA #2: CTTTGCTGTACCGAAAGTCA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation. |
|
