| GR1432 |
C. elegans |
let-7(mg279) X. Show Description
Weakly retarded differentiation of the hypodermis and exit from the molting cycle. Reference: Hayes GD, Frand AR, Ruvkun G. Development. 2006 Dec;133(23):4631-41. |
|
| MT7626 |
C. elegans |
let-7(n2853) X. Show Description
Temperature sensitive - maintain at 15C. Seam cells divide in L4-to-adult molt. Animals undergo extra molt and explode at vulva. Males have leptoderan-like tail. Animals explode or are sterile at 25C. |
|
| GR1433 |
C. elegans |
let-7(mg279) mir-84(tm1304) X. Show Description
Retarded differentiation of the hypodermis and supernumerary molt that results in adult lethality. Reference: Hayes GD, Frand AR, Ruvkun G. Development. 2006 Dec;133(23):4631-41. |
|
| SP231 |
C. elegans |
mnDp1(X;V)/+ V; unc-3(e151) let-7(mn112) X. Show Description
LETHAL LATE LARVAL SEX-INFLUENCED Maintain by picking WT. |
|
| GR1452 |
C. elegans |
veIs13 V; let-7(mn112) unc-3(e151) X; mgEx725. Show Description
veIs13 [col-19::GFP + rol-6(su1006)] V. mgEx725 [lin-4::let-7 + ttx-3::RFP]. Pick RFP+ to maintain. mgEx725 rescues lethality of let-7(mn112). Precocious expression of col-19::GFP at the L4 stage. Reference: Hayes GD, Riedel CG, Ruvkun G. 2011. Genes Dev. 2011 Oct 1;25(19):2079-92. |
|
| NOA1 |
C. elegans |
lin-12(n137n460) III; him-5(e1467) V; let-7(n2853) X. Show Description
|
|
| PQ425 |
C. elegans |
apIs320 II; unc-119(ed3) III; unc-3(e151) let-7(mn112) X. Show Description
apIs320 [let-7::unc-119(+)] II. PQ425 was created by crossing PQ320 into unc-3(e151) let-7(mn112) animals, which do not express precursor or mature let-7. unc-119(ed3) might not be homozygous in this strain. Reference: Zisoulis DG, et al. Nature. 2012;486(7404):541-544. |
|
| PQ426 |
C. elegans |
apIs404 II; unc-119(ed3) III; unc-3(e151) let-7(mn112) X. Show Description
apIs404 [let-7(delta alg-1-binding site)::unc-119(+)] II. PQ426 was created by crossing PQ404 into unc-3(e151) let-7(mn112) animals, which do not express precursor or mature let-7. unc-119(ed3) might not be homozygous in this strain. Reference: Zisoulis DG, et al. Nature. 2012;486(7404):541-544. |
|
| NOA2 |
C. elegans |
lin-12(n137n460) III; him-5(e1467) V; unc-3(e151) let-7(mn112) X. Show Description
|
|
| CGC135 |
C. elegans |
let-7(umn45[let-7p::egl-13-NLS::mScarlet-I::c-myc-NLS::linker::mODC(422-461)(E428A/E430A/E431A)::let-858 3' UTR])/tmC24 [F23D12.4(tmIs1240) unc-9(tm9719)] X. Show Description
tmIs1240 [myo-2p::venus, X: F23D12.4] X. Nuclear mScarlet-I fused to a PEST was inserted in place of the endogenous let-7 pre-miRNA via CRISPR/CAS9. Heterozygotes are wild-type GFP+ mScarlet+ and segregate wild-type GFP+ mScarlet+ heterozygotes, mScarlet+ non-GFP dead larvae (umn45 homozygotes) and Mec(Unc) non-mScarlet GFP+ (tmC24 homozygotes). Maintain by picking wild-type GFP+ mScarlet+. Left Flanking: GCAAGCAGGCGATTGGTGGACGGTC, Right Flanking: AGCTGCGTCGTCTTGCTCTCACAAc. sgRNA: AAAATTGCATAGTTCACCGG. |
|
| CT12 |
C. elegans |
zaEx5. Show Description
zaEx5 [let-7::GFP + rol-6(su1006)]. Pick GFP+ to maintain. The GFP+ animals may not always express the Roller phenotype. |
|
| GR1431 |
C. elegans |
mir-84(tm1304) X. Show Description
Enhances retarded differentiation of the hypodermis and exit from the molting cycle caused by mutations in let-7 or its paralogs. Reference: Hayes GD, Frand AR, Ruvkun G. Development. 2006 Dec;133(23):4631-41. |
|
| GR1583 |
C. elegans |
somi-1(mg415) V. Show Description
Adults slightly Dpy. Suppresses defects caused by over-expression of mir-84. Enhances retarded heterchronic phenotypes caused by a weak allele of let-7 or loss of mir-84. Reference: Hayes GD, Riedel CG, Ruvkun G. 2011. Genes Dev. 2011 Oct 1;25(19):2079-92. |
|
| GR1586 |
C. elegans |
somi-1(tm562) V. Show Description
Adults slightly Dpy. Suppresses defects caused by over-expression of mir-84. Enhances retarded heterchronic phenotypes caused by a weak allele of let-7 or loss of mir-84. Reference: Hayes GD, Riedel CG, Ruvkun G. 2011. Genes Dev. 2011 Oct 1;25(19):2079-92. |
|
| HW1329 |
C. elegans |
lin-41(xe11) I. Show Description
Egg-laying (Egl) defects and subsequent internal hatching of progeny (Bagging) in > 95% of animals. xe11 is a C-to-U point mutation in each of the endogenous let-7 complementary sites, LCS1 and LCS2 [I:C9,335,211T & I:C9,335,260T]. xe11 is a weak gain-of-function allele: mutation of two functionally relevant let-7 binding sites impairs repression by let-7 causing over-expression of LIN-41 in L4 stage animals. Reference: Ecsedi M, et al. Dev Cell. 2015 Feb 9;32(3):335-44. Do not distribute this strain; other labs should request it directly from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects. |
|
| HW1826 |
C. elegans |
lin-29(xe63[gfp::3xflag::lin-29a]) II. Show Description
Superficially wild-type. CRISPR/Cas9-engineered allele adds GFP and 3xflag tag to the N-terminus of LIN-29A. Do not distribute this strain; other labs should request it directly from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects. Reference: Aeschimann F, et al., (2019). A single let-7 target to coordinate transition to adulthood. Life Science Alliance 2, e201900335. http://dx.doi.org/10.26508/lsa.201900335 ) |
|
| HW1870 |
C. elegans |
lin-41(xe8)/lin-41(bch28[eft-3p::gfp::h2b::tbb-2 3'UTR] xe70) I. Show Description
Pick GFP+ Egl to maintain. Segregates GFP- lin-41(xe8) homozygotes (die by vulval bursting as young adults), lin-41(xe8)/lin-41(bch28[eft-3p::gfp::h2b::tbb-2 3'UTR] xe70) heterozygotes (GFP+ Egl), and lin-41(bch28[eft-3p::gfp::h2b::tbb-2 3'UTR] xe70) (GFP+ Ste Dpy). lin-41(xe8) is a deletion of let-7 binding sites in the lin-41 3'UTR. The balancer was derived from lin-41(bch28), a lin-41(0) allele in which an expression cassette that drives ubiquitous nuclear GFP from the eft-3 promoter has been inserted into the lin-41 coding sequence (Katic et al., G3 (2015) 5:1649-56). References: Katic et al., G3 (2015) 5:1649-56 for lin-41(bch28) starting allele for balancer generation. Aeschimann F, et al. (2019). A single let-7 target to coordinate transition to adulthood. Life Science Alliance 2, e201900335. for balanced line. Do not distribute this strain; other labs should request it directly from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects. |
|
| PQ320 |
C. elegans |
apIs320 II; unc-119(ed3) III. Show Description
apIs320 [let-7::unc-119(+)] II. Reference: Zisoulis DG, et al. Nature. 2012;486(7404):541-544. |
|
| PQ402 |
C. elegans |
apIs402 II; unc-119(ed3) III. Show Description
apIs402 [let-7(delta alg-1-binding site)::unc-119(+)] II. Reference: Zisoulis DG, et al. Nature. 2012;486(7404):541-544. |
|
| PQ404 |
C. elegans |
apIs404 II; unc-119(ed3) III. Show Description
apIs404 [let-7(delta alg-1-binding site)::unc-119(+)] II. Reference: Zisoulis DG, et al. Nature. 2012;486(7404):541-544. |
|
| SX328 |
C. elegans |
mjIs17 IV. Show Description
mjIs17 contains [myo-2::GFP::lin-41 + myo-2::mCherry::unc-54 (let-7 sensor)]. |
|
| SX333 |
C. elegans |
mjIs11 III; mjIs17 IV. Show Description
mjIs11 contains [myo-2::let-7 + unc-119(+)]. mjIs17contains [myo-2::GFP::lin-41 + myo-2::mCherry::unc-54 (let-7 sensor)]. |
|
| VT3500 |
C. elegans |
wIs51 V; hbl-1(ma354) X. Show Description
wIs51 [SCMp::GFP + unc-119(+)] V. GFP expression in seam cells. Gain-of-function allele causing retarded heterochronic defects including extra seam cells and absence of alae in young adult animals. ms354 is a 1120 bp deletion removing most of the hbl-1 3'UTR including all let-7-complementary sites. Sequences flanking the deletion: TTCTAATCATGGCCAGTTTCTTGCA and GTGCGTTCTTCTGTCATCATGTACA. Reference: Ilbay O & Ambros A. Development. 2019 Oct 9. pii: dev.183111. doi: 10.1242/dev.183111. |
|
| BC125 |
C. elegans |
dpy-14(e188) unc-13(e51) let-79(s81)/unc-15(e73) I. Show Description
Heterozygotes are WT and segregate more WT, paralyzed Unc and DpyUncLethal. The DpyUncs are abnormal larvae that die in early larval development. Pick WT to maintain. Note 5/92: probably has lost dpy-14. |
|
| BC148 |
C. elegans |
dpy-14(e188) let-75(s101) unc-13(e51)/unc-15(e73) I. Show Description
Heterozygotes are WT and segregate more WT, paralyzed Unc and DpyUncLethals. The DpyUncs are abnormal larvae that die in early larval development (L1). Pick WT to maintain. Previously called myo-1(s101). |
|
| BC184 |
C. elegans |
dpy-14(e188) unc-13(e51) bli-4(s90)/unc-15(e73) I. Show Description
Heterozygotes are WT and segregate WT, paralyzed Unc and DpyUncLethals. The DpyUncs are abnormal larvae which die in late larval development. Pick WT to maintain. s90 previously called let-77. See also WBPaper00003507. CGC received new stock 3/01. |
|
| BC2020 |
C. elegans |
let-70(s1132) unc-22(s7) unc-31(e169)/nT1 IV; +/nT1 V. Show Description
Heterozygotes are WT and segregate WT, Vul, UncLet (twitchers) and dead eggs. Lethal early larval. Maintain by picking WT. See also WBPaper00002501. |
|
| BC215 |
C. elegans |
dpy-14(e188) unc-13(e51) let-78(s82)/unc-15(e73) I. Show Description
Heterozygotes are WT and segregate more WT, paralyzed Unc and DpyUncLethals. The DpyUncs are abnormal larvae which die in late larval development. Pick WT to maintain. |
|
| BC2895 |
C. elegans |
let-73(s685) unc-22(s7)/nT1 IV; +/nT1 V. Show Description
Heterozygotes are WT and segregate WT, Vul, Twitcher Steriles and dead eggs. Maintain by picking WT. |
|
| BC2897 |
C. elegans |
let-72(s695) unc-22(s7)/nT1 IV; +/nT1 V. Show Description
Heterozygotes are WT and segregate WT, Vul, dead eggs, and UncLets. Lethal mid-larval. Maintain by picking WT. |
|
| BC2898 |
C. elegans |
let-71(s692) unc-22(s7)/nT1 IV; +/nT1 V. Show Description
Heterozygotes are WT and segregate WT, Vuls and Lethal Twitchers (Late larval lethals). Maintain by picking WT. |
|
| BC4142 |
C. elegans |
dpy-17(e164) let-769(s2432) unc-32(e189) III; sDp3 (III;f). Show Description
Animals with the duplication are Unc. Animals which have lost the duplication are DpyUnc and arrest in mid to late larval development. |
|
| BC4143 |
C. elegans |
dpy-17(e164) mup-4(s2433) unc-32(e189) III; sDp3 (III;f). Show Description
Animals with the duplication are Unc. Animals which have lost the duplication are DpyUnc and arrest in early larval development. s2433 previously assigned to let-701. |
|
| BC4144 |
C. elegans |
dpy-17(e164) let-723(s2434) unc-32(e189) III; sDp3 (III;f). Show Description
Animals with the duplication are Unc. Animals which have lost the duplication are DpyUnc and Sterile as adults. |
|
| BC4145 |
C. elegans |
let-738(s2435) dpy-17(e164) unc-32(e189) III; sDp3 (III;f). Show Description
Animals with the duplication are Unc. Animals which have lost the duplication arrest as embryos. |
|
| BC4149 |
C. elegans |
dpy-17(e164) let-712(s2439) unc-32(e189) III; sDp3 (III;f). Show Description
Maintain by picking Uncs. DpyUncs arrest as early larvae. |
|
| BC4151 |
C. elegans |
dpy-17(e164) let-972(s2441) unc-32(e189) III; sDp3 (III;f). Show Description
Maintain by picking Uncs. DpyUncs arrest at early larvae. s2441 previously assigned to let-703. |
|
| BC4152 |
C. elegans |
dpy-17(e164) let-771(s2442) unc-32(e189) III; sDp3 (III;f). Show Description
Animals with the duplication are Unc. Animals which have lost the duplication are DpyUnc and arrest as Sterile Adults. |
|
| BC4153 |
C. elegans |
dpy-17(e164) let-764(s2443) unc-32(e189) III; sDp3 (III;f). Show Description
Animals with the duplication are Unc. Animals which have lost the duplication are DpyUnc and arrest as early larva. s2443 pka let-708. |
|
| BC4154 |
C. elegans |
dpy-17(e164) let-709(s2444) unc-32(e189) III; sDp3 (III;f). Show Description
Maintain by picking Uncs. DpyUncs die as embryos. This is a slow developing strain. |
|
| BC4155 |
C. elegans |
dpy-17(e164) let-718(s2445) unc-32(e189) III; sDp3 (III;f). Show Description
Maintain by picking Uncs. DpyUncs arrest as early larvae. This is a slow developing strain. Received new stock 9/03. 3/09: Buelow lab reported not seeing lethal DpyUncs. |
|
| BC4156 |
C. elegans |
let-750(s2446) dpy-17(e164) unc-32(e189) III; sDp3 (III;f). Show Description
Maintain by picking Uncs. DpyUncs arrest as early larvae. This is a slow developing strain. |
|
| BC4157 |
C. elegans |
dpy-17(e164) let-721(s2447) unc-32(e189) III; sDp3 (III;f). Show Description
Animals with the duplication are Unc. Animals which have lost the duplication are DpyUncs and are sterile adults. |
|
| BC4159 |
C. elegans |
dpy-17(e164) let-713(s2449) unc-32(e189) III; sDp3 (III;f). Show Description
Animals with the duplication are Unc. Animals which have lost the duplication are DpyUncs and arrest at the mid-larval stage of development. |
|
| BC4163 |
C. elegans |
let-776(s2453) dpy-17(e164) unc-32(e189) III; sDp3 (III;f). Show Description
Animals with the duplication are Unc. Animals which have lost the duplication are DpyUnc and arrest at a mid-larval stage of development. |
|
| BC4164 |
C. elegans |
dpy-17(e164) let-725(s2454) unc-32(e189) III; sDp3 (III;f). Show Description
Animals with the duplication are Unc. Animals which have lost the duplication are DpyUncs and are sterile adults (some lay eggs that don't hatch). |
|
| BC4165 |
C. elegans |
dpy-17(e164) let-719(s2455) unc-32(e189) III; sDp3 (III;f). Show Description
Animals with the duplication are Unc. Animals which have lost the duplication are DpyUnc and arrest as Sterile Adults. |
|
| BC4166 |
C. elegans |
dpy-17(e164) let-747(s2456) unc-32(e189) III; sDp3 (III;f). Show Description
Maintain by picking Uncs. DpyUncs arrest at early to mid larval stage. |
|
| BC4167 |
C. elegans |
dpy-17(e164) let-716(s2457) unc-32(e189) III; sDp3 (III;f). Show Description
Animals with the duplication are Unc. Animals which have lost the duplication are DpyUncs which arrest at an early larval stage. |
|
| BC4168 |
C. elegans |
dpy-17(e164) let-704(s2458) unc-32(e189) III; sDp3 (III;f). Show Description
Animals with the duplication are Unc. Animals which have lost the duplication are DpyUnc and arrest in mid-late larval development. |
|