More Fields
Strain Species Genotype
AM263 C. elegans rmIs175. Show Description
rmIs175 [unc-54p::Hsa-sod-1 (WT)::YFP]. Array encodes wild-type human SOD-1. YFP expression in body wall muscle. Array is prone to silencing; maintain by picking worms displaying typical aggregation patterns. Reference: Gidalevitz T, et al., PLoS Genet. 2009 Mar;5(3):e1000399.
BC934 C. elegans let-59(s175) unc-22(s7)/+ + IV. Show Description
Heterozygotes are WT and segregate WT and dead eggs. Hets twitch in 1% nicotine. Maintain by picking Twitchers in 1% Nicotine.
HA2823 C.elegans smn-1(rt248) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III); nuIs175 X. Show Description
nuIs175 [myo-2p::RFP + unc-129p::RFP::snb-1] X. smn-1 heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP rt248 homozygotes (larval arrest). Homozygous hT2 [bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. NOTE: myo-2p::RFP is not visible in this strain. rt248 is a 8 bp deletion in smn-1. [rt248: TTTTGATTAGC--------ATCCCAAAC] [wild-type: TTTTGATTAGCTCCGTATCATCCCAAAC] Reference: Dimitriadi M, et al. Proc Natl Acad Sci U S A. 2016 Jul 26;113(30):E4377-86. O'Hern PJ, et al. Elife. 2017 May 2;6. pii: e20752.
HA2825 C.elegans smn-1(ok355) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III); rtSi10 IV; nuIs175 X. Show Description
rtSi10 [smn-1p::smn-1 + Cbr-unc-119(+)] IV. nuIs175 [myo-2p::RFP + unc-129p::RFP::snb-1] X. rtSi10 transgene partially rescues smn-1(ok355): smn-1 homozygotes normally arrest as larvae, but somatic defects, including late larval lethality, are ameliorated by rtSi10. Sterility in smn-1(ok355) homozygotes is not rescued by rtSi10. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok355 homozygotes (sterile due to partial rescue by rtSi10). Homozygous hT2[bli-4 let-? qIs48] inviable. Note: qIs48 has been observed to recombine off hT2, typically leaving behind a functional homozygous viable hT2 with Bli-4 phenotype. Pick WT GFP and check for correct segregation of progeny to maintain. Reference: O'Hern PJ, et al. eLife 2017;6:e20752 doi: 10.7554/eLife.20752
MT15695 C. elegans nIs175 IV; ceh-34(4796) V. Show Description
nIs175 [ceh-28p::4xNLS::GFP + lin-15(+)] IV. Extra GFP+ M4 observed in nIs175. Reference: Takashi H, et al. PNAS 2010 Aug 31;107(35):15479-84.
MT19851 C. elegans sptf-3(tm607)/hIn1 [unc-101(sy241)] nIs425 I; nIs175 IV. Show Description
nIs425 [myo-2p::GFP] I. nIs175 [ceh-28p::4NLS::GFP + lin-15(+)] IV. Heterozygotes are GFP+ wild type and segregate GFP+ Unc, GFP+ wild type, and GFP- sptf-3 homozygotes. nIs425 was integrated into sptf-3(tm607)/hIn1[unc-101(sy241)] I. The position of integration appears to be close to or lie within the region covered by hIn1: sptf-3(tm607) heterozygotes are GFP+ whereas sptf-3(tm607) homozygotes do not express GFP in the pharynx. Reference: Hirose T, Horvitz HR. Nature. 2013 Aug 15;500(7462):354-8.
OP175 C. elegans unc-119(ed3) III; wgIs175. Show Description
wgIs175 [lir-2::TY1::EGFP::3xFLAG + unc-119(+)]. TY1::EGFP::3xFLAG tag inserted in frame at C-terminus of coding sequence by recombineering. Expression of transgene confirmed by GFP. References: Sarov, M, et al. Nat Methods (2006) 10:839-44. Zhong, M, et al. PLoS Genet (2010) 6(2):e1000848. Strain was constructed as part of the Regulatory Element Project, part of modENCODE (http://www.modencode.org)
BC3282 C. elegans unc-22(s7) unc-31(e169) let-319(s1754)/nT1 IV; +/nT1 V. Show Description
Heterozygotes are WT and segregate WT, Vul and UncLet. Lethal late larval. Maintain by picking WT.
JH2427 C. elegans unc-119(ed3) III; axIs1751. Show Description
axIs1751 [pie-1p::GFP::histone H2B::pos-1 3'utr + unc-119(+)]. Transgene is prone to silencing -- maintain at 25C. Transgene is slightly unstable. Pick non-Unc, GFP+ worms to maintain.
JH2428 C. elegans unc-119(ed3) III; axIs1752. Show Description
axIs1752 [fbf-1p::GFP::histone H2B:tbb-2 3'utr + unc-119(+)]. Maintaining at 25C might reduce the chance of transgene silencing.
JH2432 C. elegans unc-119(ed3) III; axIs1756. Show Description
axIs1756 [fbf-2p::GFP::histone H2B:tbb-2 3'utr + unc-119(+)]. Maintaining at 25C might reduce the chance of transgene silencing.
JH2434 C. elegans unc-119(ed3) III; axIs1758. Show Description
axIs1758 [spn-4p::GFP::histone H2B:tbb-2 3'utr + unc-119(+)]. Transgene is slightly unstable. Pick non-Unc, GFP+ worms to maintain.
JH2435 C. elegans unc-119(ed3) III; axIs1759. Show Description
axIs1759 [msp-56p::GFP::histone H2B:tbb-2 3'utr + unc-119(+)].