MLC613 |
C.elegans |
unc-9(luc30) X. Show Description
luc30 removes mir-791/mir-790 binding sites in the unc-9 3'UTR. Reference: Drexel T, et al. Genes Dev. 2016 Sep 15;30(18):2042-2047.
|
|
CB101 |
C. elegans |
unc-9(e101) X. Show Description
Unc.
|
|
CW129 |
C. elegans |
unc-9(fc16) X. Show Description
|
|
FH85 |
C. elegans |
unc-9(ec27) X. Show Description
Unc. Males are fertile.
|
|
HH29 |
C. elegans |
unc-9(hs6) X. Show Description
Cold sensitive Unc.
|
|
HH31 |
C. elegans |
unc-9(hs7) X. Show Description
Cold sensitive Unc.
|
|
HH35 |
C. elegans |
unc-9(hs8) X. Show Description
Cold sensitive Unc.
|
|
FX30237 |
C. elegans |
tmC24 [unc-9(tm9723)] X. Show Description
Break points: In(mec-10 Y7A5A.20 In(odr-7 F59F4.2)) X. Covered region (Mb) 7.4 (8.5..15.8) Unc Mec. Reference: Dejima K, et al. Cell Rep. 2018 Jan 2;22(1):232-241.
|
|
SP15 |
C. elegans |
unc-9(e101) unc-3(e151) X. Show Description
|
|
SP928 |
C. elegans |
dpy-6(e14) unc-9(e101) X. Show Description
DpyUnc.
|
|
ZM3087 |
C. elegans |
unc-9(fc16) unc-7(e5) X. Show Description
Kinkers. References: Yeh E, et al. J Neurosci. 2009 Apr 22;29(16):5207-17. Kawano T, et al. Neuron. 2011 Nov 17;72(4):572-86.
|
|
FX30186 |
C. elegans |
tmC24 [F23D12.4(tmIs1233) unc-9(tm9718)] X. Show Description
Break points: In(mec-10 Y7A5A.20 In(odr-7 F59F4.2)) X. Covered region (Mb) 7.4 (8.5..15.8) Balancer marked with myo-2p::mCherry. Unc Mec. Reference: Dejima K, et al. Cell Rep. 2018 Jan 2;22(1):232-241.
|
|
FX30194 |
C. elegans |
tmC24 [F23D12.4(tmIs1240) unc-9(tm9719)] X. Show Description
Break points: In(mec-10 Y7A5A.20 In(odr-7 F59F4.2)) X. Covered region (Mb) 7.4 (8.5..15.8) Balancer marked with myo-2p::Venus. Unc Mec. Reference: Dejima K, et al. Cell Rep. 2018 Jan 2;22(1):232-241.
|
|
FX30252 |
C. elegans |
tmC24 [F23D12.4(tmIs1240) unc-9(tm9719)] X; tmEx4950. Show Description
tmIs1240 [myo-2p::Venus, X: F23D12.4] X. tmEx4950 [unc-9(+) + vha-6p::GFP]. Pick non-Unc with bright GFP+ in gut to maintain array. Balancer marked with myo-2p::Venus. Mec (Unc). Balancer break points: In(mec-10 Y7A5A.20 In(odr-7 F59F4.2)) X. Covered region (Mb) 7.4 (8.5..15.8) Males carrying the array (intestinal GFP) can mate. Reference: Dejima K, et al. Cell Rep. 2018 Jan 2;22(1):232-241.
|
|
FX30253 |
C. elegans |
tmC24 [F23D12.4(tmIs1233) unc-9(tm9718)] X; tmEx4950. Show Description
tmIs1233 [myo-2p::mCherry, X: F23D12.4] X. tmEx4950 [unc-9(+) + vha-6p::GFP]. Pick non-Unc with bright GFP+ in gut to maintain array. Balancer marked with myo-2p::mCherry. Mec (Unc). Balancer break points: In(mec-10 Y7A5A.20 In(odr-7 F59F4.2)) X. Covered region (Mb) 7.4 (8.5..15.8) Males carrying the array (intestinal GFP) can mate. Reference: Dejima K, et al. Cell Rep. 2018 Jan 2;22(1):232-241.
|
|
MT2764 |
C. elegans |
unc-9(e101) lin-15B&lin-15A(n765) X. Show Description
Temperature-sensitive Lin.
|
|
TY1909 |
C. elegans |
yDp4/+ (X;A); kynu-1(e1003) unc-9(e101) X. Show Description
Animals heterozygous for yDp4 are Dpy non-Flu non-Unc. Animals which have lost yDp4 are FluUnc. Animals homozygous for yDp4 are dead (embryonic lethal). Low percentage of non-Dpy non-Unc progeny. These give a high percentage of Unc male self-progeny and are inferred to be yDp4 XO hermaphrodites.
|
|
TY1910 |
C. elegans |
yDp5 (X;A); lon-2(e678) unc-9(e101) X. Show Description
Lon non-Unc hermaphrodite strain. yDp5 is homozygous viable. yDp5/+ XO animals are fertile males.
|
|
TY1911 |
C. elegans |
yDp6 (X;A); lon-2(e678) unc-9(e101) X. Show Description
Lon non-Unc hermaphrodites. yDp6 is homozygous viable. yDp6/+ XO animals are fertile males.
|
|
TY1912 |
C. elegans |
yDp7/+ (X;A); lon-2(e678) unc-9(e101) X. Show Description
Animals heterozygous for yDp7 are Lon non-Unc. Animals which have lost yDp7 are LonUnc. Animals homozygous for yDp7 are Dpy and sick hermaphrodites. yDp7/+ XO males are Dpy and infertile. yDp7 attached to an autosome.
|
|
TY1913 |
C. elegans |
yDp8/+ (X;A); lon-2(e678) unc-9(e101) X. Show Description
Animals heterozygous for yDp8 are Lon non-Unc hermaphrodites. Animals which have lost yDp8 are LonUnc. Animals homozygous for yDp8 are Dpy and sick hermaphrodites. yDp8/+ XO males are Dpy and infertile.
|
|
TY1914 |
C. elegans |
yDp9 (X;A); lon-2(e678) unc-9(e101) X. Show Description
Lon non-Unc hermaphrodite strain. yDp9 is homozygous viable. yDp9/+ XO animals are fertile males.
|
|
TY1915 |
C. elegans |
yDp10/+ (X;A); lon-2(e678) unc-9(e101) X. Show Description
Animals heterozygous for yDp10 are Lon non-Unc hermaphrodites. Animals which have lost yDp10 are LonUnc. Animals homozygous for yDp10 are Dpy and sick hermaphrodites. yDp10/+ XO animals are Dpy and infertile males.
|
|
TY1916 |
C. elegans |
yDp11 (X;IV); lon-2(e678) unc-9(e101) X. Show Description
Lon non-Unc hermaphrodite strain. yDp11 is homozygous viable. yDp11/+ XO animals are fertile males.
|
|
TY1917 |
C. elegans |
lon-2(e678) unc-9(e101) X; yDp12 (X;f). Show Description
Free duplication. Animals with yDp12 are Lon non-Unc hermaphrodites. Animals which have lost yDp12 are LonUnc. yDp12/+ XO animals are fertile males.
|
|
MT4578 |
C. elegans |
lin-1(e1275) dpy-13(e184) IV; unc-9(e101) X. Show Description
Temperature sensitive Muv. Semi-dominant Dpy. Unc-moves backward better than forward; slight kinker in forward movement; larvae more severly Unc.
|
|
SV411 |
C. elegans |
heDf1 maIs103/lon-2(e678) unc-9(e101) X. Show Description
maIs103[rnr::GFP unc-36(+)] X. The heDf1 deletion includes cdk-4. Heterozygotes produce 1/4 thin, sterile, uncoordinated animals that fail to undergo postembryonic somatic cell divisions. heDf1 mutants are of L1 size, smaller than cdk-4 mutants. lon-2 and unc-9 do not exactly balance heDf1, but unc-9 is pretty close. It should also be possible to follow the heterozygotes by looking at the GFP. Despite trying, unable to separate the maIs integration from heDf1 or the other cdk-4 alleles. By maintaining animals with GFP (visible especially in early animals and in eggs) you should be able to maintain heDf1. rnr::GFP is expressed during S-phase in heterozygous animals. rnr::GFP expression is not detected in heDf1 animals. maIs103 is tightly linked to heDf1. Maintain by picking several single animals and scoring for 1/4 mutant progeny.
|
|
GR3055 |
C. elegans |
suox-1(mg663)/tmC24 [F23D12.4(tmIs1240) unc-9(tm9719)] X Show Description
Larval lethal mutation balanced by tmC24 [F23D12.4(tmIs1240) unc-9(tm9719)]. Balancer marked with myo-2p::Venus. Maintain by picking non-Unc GFP+ animals. Heterozygotes are wild-type GFP+ and segregate wild-type GFP+ heterozygotes, non-GFP mg663 homozygotes (lethal), and Unc GFP+ (homozygous tmC24). Reference: Warnhoff K & Ruvkun G. Nat Chem Biol. 2019 Mar 25. doi: 10.1038/s41589-019-0249-y.
|
|
CGC135 |
C. elegans |
let-7(umn45[let-7p::egl-13-NLS::mScarlet-I::c-myc-NLS::linker::mODC(422-461)(E428A/E430A/E431A)::let-858 3' UTR])/tmC24 [F23D12.4(tmIs1240) unc-9(tm9719)] X. Show Description
tmIs1240 [myo-2p::venus, X: F23D12.4] X. Nuclear mScarlet-I fused to a PEST was inserted in place of the endogenous let-7 pre-miRNA via CRISPR/CAS9. Heterozygotes are wild-type GFP+ mScarlet+ and segregate wild-type GFP+ mScarlet+ heterozygotes, mScarlet+ non-GFP dead larvae (umn45 homozygotes) and Mec(Unc) non-mScarlet GFP+ (tmC24 homozygotes). Maintain by picking wild-type GFP+ mScarlet+. Left Flanking: GCAAGCAGGCGATTGGTGGACGGTC, Right Flanking: AGCTGCGTCGTCTTGCTCTCACAAc. sgRNA: AAAATTGCATAGTTCACCGG.
|
|
OH15278 |
C. elegans |
pha-1(e2123) III; otEx7109. Show Description
otEx7109 [unc-9(fosmid WRM0611aH10)::SL2::NLS::YFP::H2B + pha-1(+) + myo-2p::BFP]. Maintain at 25C or pick BFP+ to retain array. Reference: Bhattacharya A, et al. Cell. 2019 Feb 21;176(5):1174-1189.e16.
|
|
CB3060 |
C. elegans |
sup-9(n180) II; unc-93(e1500) III. Show Description
Recessive Suppressor. XO Fertile hermaphrodite. WT phenotype.
|
|
DV2208 |
C. elegans |
unc-97(su110) X. Show Description
Made by outcrossing HE110 four times. su110 is moderately Smg suppressible: HE110 animals are significantly less Unc than DV2208, and HE110 animal are also pVul, which is characteristic of Smg mutations.
|
|
GB244 |
C. elegans |
unc-96(sf18) X. Show Description
Adults are Unc - reduced motility; characteristic birefrigent "needles" in body wall muscle cells by polarized light microscopy; contain accumulations of paramyosin and UNC-98. Phenotype (needles and accumulations of paramyosin) is suppressed by growth at 15C or by starvation.
|
|
GB246 |
C. elegans |
unc-98(sf19) X. Show Description
Adults are Unc - reduced motility; characteristic birefrigent "needles" in body wall muscle cells by polarized light microscopy; contain accumulations of paramyosin and UNC-96.
|
|
GB247 |
C. elegans |
unc-94(sf20) I. Show Description
Adults are Unc - reduced motility; disorganization of myofilament lattice in body wall muscle cells by polarized light microscopy; abnormal accululations of F-actin near muscle cell-cell boundaries.
|
|
GS422 |
C. elegans |
evl-21(ar122) unc-36(e251)/unc-93(e1500) dpy-17(e164) III. Show Description
Heterozygotes are WT and segregate WT, DpyUncs and Sterile Unc-36 which have an everted vulva. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
|
|
HE110 |
C. elegans |
smg-1(re1) I; unc-97(su110) X. Show Description
Variable phenotype-WT when relaxed. Paralyzed. Dave Reiner identified smg-1(re1) in this strain.
|
|
HE130 |
C. elegans |
unc-98(su130) X. Show Description
Movement WT. Body muscle abnormal.
|
|
HE151 |
C. elegans |
unc-96(su151) X. Show Description
Movement WT. Body muscle abnormal.
|
|
HE177 |
C. elegans |
unc-94(su177) I. Show Description
Slow moving Unc. Body muscle abnormal. Slightly small.
|
|
HE33 |
C. elegans |
unc-95(su33) I. Show Description
Unc-very slow or paralysed. Egl. Semi-dominant.
|
|
JK659 |
C. elegans |
mog-3(q74)/unc-93(e1500) dpy-17(e164) III. Show Description
Heterozygote. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
|
|
LP893 |
C. elegans |
unc-94a(cp437[mNG-C1::unc-94a]) I. Show Description
mNG reporter inserted into endogenous unc-94 locus, specifically tagging the UNC-94A isoform. Reference: Zhang P, et al. 2023 Sep 4;222(9):e202302102.
doi: 10.1083/jcb.202302102.
|
|
LP894 |
C. elegans |
unc-94b(cp438[mNG-C1::unc-94b]) I. Show Description
mNG reporter inserted into endogenous unc-94b locus, specifically tagging the UNC-94B isoform. Reference: Zhang P, et al. 2023 Sep 4;222(9):e202302102. doi: 10.1083/jcb.202302102. PMID: 37351566.
|
|
LP896 |
C. elegans |
unc-94(cp439[unc-94::mNG-C1]) I; cap-1(cp436[mScarlet-I-C1::cap-1]) IV. Show Description
mNG reporter inserted into endogenous unc-94b locus. m-Scarlet-I reporter inserted into endogenous cap-1 locus. Reference: Zhang P, et al. 2023 Sep 4;222(9):e202302102. doi: 10.1083/jcb.202302102. PMID: 37351566.
|
|
MT1122 |
C. elegans |
sup-11(n403) I; unc-93(e1500) III. Show Description
Phenotype: small, scrawny, thin, lays few eggs. unc-93(e1500) rubberband phenotype is completely suppressed by sup-11(n403) so only sup-11 phenotype is visible. n403 is semidominant.
|
|
MT1132 |
C. elegans |
unc-93(e1500) sup-18(n463) III. Show Description
|
|
MT16492 |
C. elegans |
uaf-1(n4588) III. Show Description
Suppressor of unc-93(e1500). Weak maternal effect sterile and dumpy. Reference: Ma L, Horvitz HR. PLoS Genet. 2009 Nov;5(11):e1000708.
|
|
MT180 |
C. elegans |
sup-9(n180) II. Show Description
Suppresses unc-93(e1500).
|
|
MT19321 |
C. elegans |
unc-93(e1500) III. Show Description
Use as a replacement strain for SP457. Rubberband Unc.
|
|