More Fields
Strain Species Genotype
MLC613 C.elegans unc-9(luc30) X. Show Description
luc30 removes mir-791/mir-790 binding sites in the unc-9 3'UTR. Reference: Drexel T, et al. Genes Dev. 2016 Sep 15;30(18):2042-2047.
CB101 C. elegans unc-9(e101) X. Show Description
CW129 C. elegans unc-9(fc16) X. Show Description
FH85 C. elegans unc-9(ec27) X. Show Description
Unc. Males are fertile.
HH29 C. elegans unc-9(hs6) X. Show Description
Cold sensitive Unc.
HH31 C. elegans unc-9(hs7) X. Show Description
Cold sensitive Unc.
HH35 C. elegans unc-9(hs8) X. Show Description
Cold sensitive Unc.
FX30237 C. elegans tmC24 [unc-9(tm9723)] X. Show Description
Break points: In(mec-10 Y7A5A.20 In(odr-7 F59F4.2)) X. Covered region (Mb) 7.4 (8.5..15.8) Unc Mec. Reference: Dejima K, et al. Cell Rep. 2018 Jan 2;22(1):232-241.
SP15 C. elegans unc-9(e101) unc-3(e151) X. Show Description
SP928 C. elegans dpy-6(e14) unc-9(e101) X. Show Description
ZM3087 C. elegans unc-9(fc16) unc-7(e5) X. Show Description
Kinkers. References: Yeh E, et al. J Neurosci. 2009 Apr 22;29(16):5207-17. Kawano T, et al. Neuron. 2011 Nov 17;72(4):572-86.
FX30186 C. elegans tmC24 [F23D12.4(tmIs1233) unc-9(tm9718)] X. Show Description
Break points: In(mec-10 Y7A5A.20 In(odr-7 F59F4.2)) X. Covered region (Mb) 7.4 (8.5..15.8) Balancer marked with myo-2p::mCherry. Unc Mec. Reference: Dejima K, et al. Cell Rep. 2018 Jan 2;22(1):232-241.
FX30194 C. elegans tmC24 [F23D12.4(tmIs1240) unc-9(tm9719)] X. Show Description
Break points: In(mec-10 Y7A5A.20 In(odr-7 F59F4.2)) X. Covered region (Mb) 7.4 (8.5..15.8) Balancer marked with myo-2p::Venus. Unc Mec. Reference: Dejima K, et al. Cell Rep. 2018 Jan 2;22(1):232-241.
FX30252 C. elegans tmC24 [F23D12.4(tmIs1240) unc-9(tm9719)] X; tmEx4950. Show Description
tmEx4950 [unc-9(+) + vha-6p::GFP]. Break points: In(mec-10 Y7A5A.20 In(odr-7 F59F4.2)) X. Covered region (Mb) 7.4 (8.5..15.8) Balancer marked with myo-2p::Venus. Mec (Unc). Pick non-Unc GFP+ to maintain array. Males carrying the array (intestinal GFP) can mate. Reference: Dejima K, et al. Cell Rep. 2018 Jan 2;22(1):232-241.
FX30253 C. elegans tmC24 [F23D12.4(tmIs1233) unc-9(tm9718)] X; tmEx4950. Show Description
tmEx4950 [unc-9(+) + vha-6p::GFP]. Break points: In(mec-10 Y7A5A.20 In(odr-7 F59F4.2)) X. Covered region (Mb) 7.4 (8.5..15.8) Balancer marked with myo-2p::mCherry. Mec (Unc). Pick non-Unc GFP+ to maintain array. Males carrying the array (intestinal GFP) can mate. Reference: Dejima K, et al. Cell Rep. 2018 Jan 2;22(1):232-241.
MT2764 C. elegans unc-9(e101) lin-15B&lin-15A(n765) X. Show Description
Temperature-sensitive Lin.
TY1909 C. elegans yDp4/+ (X;A); kynu-1(e1003) unc-9(e101) X. Show Description
Animals heterozygous for yDp4 are Dpy non-Flu non-Unc. Animals which have lost yDp4 are FluUnc. Animals homozygous for yDp4 are dead (embryonic lethal). Low percentage of non-Dpy non-Unc progeny. These give a high percentage of Unc male self-progeny and are inferred to be yDp4 XO hermaphrodites.
TY1910 C. elegans yDp5 (X;A); lon-2(e678) unc-9(e101) X. Show Description
Lon non-Unc hermaphrodite strain. yDp5 is homozygous viable. yDp5/+ XO animals are fertile males.
TY1911 C. elegans yDp6 (X;A); lon-2(e678) unc-9(e101) X. Show Description
Lon non-Unc hermaphrodites. yDp6 is homozygous viable. yDp6/+ XO animals are fertile males.
TY1912 C. elegans yDp7/+ (X;A); lon-2(e678) unc-9(e101) X. Show Description
Animals heterozygous for yDp7 are Lon non-Unc. Animals which have lost yDp7 are LonUnc. Animals homozygous for yDp7 are Dpy and sick hermaphrodites. yDp7/+ XO males are Dpy and infertile. yDp7 attached to an autosome.
TY1913 C. elegans yDp8/+ (X;A); lon-2(e678) unc-9(e101) X. Show Description
Animals heterozygous for yDp8 are Lon non-Unc hermaphrodites. Animals which have lost yDp8 are LonUnc. Animals homozygous for yDp8 are Dpy and sick hermaphrodites. yDp8/+ XO males are Dpy and infertile.
TY1914 C. elegans yDp9 (X;A); lon-2(e678) unc-9(e101) X. Show Description
Lon non-Unc hermaphrodite strain. yDp9 is homozygous viable. yDp9/+ XO animals are fertile males.
TY1915 C. elegans yDp10/+ (X;A); lon-2(e678) unc-9(e101) X. Show Description
Animals heterozygous for yDp10 are Lon non-Unc hermaphrodites. Animals which have lost yDp10 are LonUnc. Animals homozygous for yDp10 are Dpy and sick hermaphrodites. yDp10/+ XO animals are Dpy and infertile males.
TY1916 C. elegans yDp11 (X;IV); lon-2(e678) unc-9(e101) X. Show Description
Lon non-Unc hermaphrodite strain. yDp11 is homozygous viable. yDp11/+ XO animals are fertile males.
TY1917 C. elegans lon-2(e678) unc-9(e101) X; yDp12 (X;f). Show Description
Free duplication. Animals with yDp12 are Lon non-Unc hermaphrodites. Animals which have lost yDp12 are LonUnc. yDp12/+ XO animals are fertile males.
MT4578 C. elegans lin-1(e1275) dpy-13(e184) IV; unc-9(e101) X. Show Description
Temperature sensitive Muv. Semi-dominant Dpy. Unc-moves backward better than forward; slight kinker in forward movement; larvae more severly Unc.
SV411 C. elegans heDf1 maIs103/lon-2(e678) unc-9(e101) X. Show Description
maIs103[rnr::GFP unc-36(+)] X. The heDf1 deletion includes cdk-4. Heterozygotes produce 1/4 thin, sterile, uncoordinated animals that fail to undergo postembryonic somatic cell divisions. heDf1 mutants are of L1 size, smaller than cdk-4 mutants. lon-2 and unc-9 do not exactly balance heDf1, but unc-9 is pretty close. It should also be possible to follow the heterozygotes by looking at the GFP. Despite trying, unable to separate the maIs integration from heDf1 or the other cdk-4 alleles. By maintaining animals with GFP (visible especially in early animals and in eggs) you should be able to maintain heDf1. rnr::GFP is expressed during S-phase in heterozygous animals. rnr::GFP expression is not detected in heDf1 animals. maIs103 is tightly linked to heDf1. Maintain by picking several single animals and scoring for 1/4 mutant progeny.
GR3055 C. elegans suox-1(mg663)/tmC24 [F23D12.4(tmIs1240) unc-9(tm9719)] X Show Description
Larval lethal mutation balanced by tmC24 [F23D12.4(tmIs1240) unc-9(tm9719)]. Balancer marked with myo-2p::Venus. Maintain by picking non-Unc GFP+ animals. Heterozygotes are wild-type GFP+ and segregate wild-type GFP+ heterozygotes, non-GFP mg663 homozygotes (lethal), and Unc GFP+ (homozygous tmC24). Reference: Warnhoff K & Ruvkun G. Nat Chem Biol. 2019 Mar 25. doi: 10.1038/s41589-019-0249-y.
CGC135 C. elegans let-7(umn45[let-7p::egl-13-NLS::mScarlet-I::c-myc-NLS::linker::mODC(422-461)(E428A/E430A/E431A)::let-858 3' UTR])/tmC24 [F23D12.4(tmIs1240) unc-9(tm9719)] X. Show Description
tmIs1240 [myo-2p::venus, X: F23D12.4] X. Nuclear mScarlet-I fused to a PEST was inserted in place of the endogenous let-7 pre-miRNA via CRISPR/CAS9. Heterozygotes are wild-type GFP+ mScarlet+ and segregate wild-type GFP+ mScarlet+ heterozygotes, mScarlet+ non-GFP dead larvae (umn45 homozygotes) and Mec(Unc) non-mScarlet GFP+ (tmC24 homozygotes). Maintain by picking wild-type GFP+ mScarlet+. Left Flanking: GCAAGCAGGCGATTGGTGGACGGTC, Right Flanking: AGCTGCGTCGTCTTGCTCTCACAAc. sgRNA: AAAATTGCATAGTTCACCGG.
OH15278 C. elegans pha-1(e2123) III; otEx7109. Show Description
otEx7109 [unc-9(fosmid WRM0611aH10)::SL2::NLS::YFP::H2B + pha-1(+) + myo-2p::BFP]. Maintain at 25C or pick BFP+ to retain array. Reference: Bhattacharya A, et al. Cell. 2019 Feb 21;176(5):1174-1189.e16.
CB3060 C. elegans sup-9(n180) II; unc-93(e1500) III. Show Description
Recessive Suppressor. XO Fertile hermaphrodite. WT phenotype.
DV2208 C. elegans unc-97(su110) X. Show Description
Made by outcrossing HE110 four times. su110 is moderately Smg suppressible: HE110 animals are significantly less Unc than DV2208, and HE110 animal are also pVul, which is characteristic of Smg mutations.
GB244 C. elegans unc-96(sf18) X. Show Description
Adults are Unc - reduced motility; characteristic birefrigent "needles" in body wall muscle cells by polarized light microscopy; contain accumulations of paramyosin and UNC-98. Phenotype (needles and accumulations of paramyosin) is suppressed by growth at 15C or by starvation.
GB246 C. elegans unc-98(sf19) X. Show Description
Adults are Unc - reduced motility; characteristic birefrigent "needles" in body wall muscle cells by polarized light microscopy; contain accumulations of paramyosin and UNC-96.
GB247 C. elegans unc-94(sf20) I. Show Description
Adults are Unc - reduced motility; disorganization of myofilament lattice in body wall muscle cells by polarized light microscopy; abnormal accululations of F-actin near muscle cell-cell boundaries.
GS422 C. elegans evl-21(ar122) unc-36(e251)/unc-93(e1500) dpy-17(e164) III. Show Description
Heterozygotes are WT and segregate WT, DpyUncs and Sterile Unc-36 which have an everted vulva. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
HE110 C. elegans smg-1(re1) I; unc-97(su110) X. Show Description
Variable phenotype-WT when relaxed. Paralyzed. Dave Reiner identified smg-1(re1) in this strain.
HE130 C. elegans unc-98(su130) X. Show Description
Movement WT. Body muscle abnormal.
HE151 C. elegans unc-96(su151) X. Show Description
Movement WT. Body muscle abnormal.
HE177 C. elegans unc-94(su177) I. Show Description
Slow moving Unc. Body muscle abnormal. Slightly small.
HE33 C. elegans unc-95(su33) I. Show Description
Unc-very slow or paralysed. Egl. Semi-dominant.
JK659 C. elegans mog-3(q74)/unc-93(e1500) dpy-17(e164) III. Show Description
Heterozygote. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
MT1122 C. elegans sup-11(n403) I; unc-93(e1500) III. Show Description
Phenotype: small, scrawny, thin, lays few eggs. unc-93(e1500) rubberband phenotype is completely suppressed by sup-11(n403) so only sup-11 phenotype is visible. n403 is semidominant.
MT1132 C. elegans unc-93(e1500) sup-18(n463) III. Show Description
MT16492 C. elegans uaf-1(n4588) III. Show Description
Suppressor of unc-93(e1500). Weak maternal effect sterile and dumpy. Reference: Ma L, Horvitz HR. PLoS Genet. 2009 Nov;5(11):e1000708.
MT180 C. elegans sup-9(n180) II. Show Description
Suppresses unc-93(e1500).
MT19321 C. elegans unc-93(e1500) III. Show Description
Use as a replacement strain for SP457. Rubberband Unc.
MT200 C. elegans unc-93(n200) III. Show Description
Weak Rubberband.
MT2056 C. elegans sup-10(n983) X. Show Description
Class 3 (neomorphic) allele. Uncoordinated, rubberband paralysis like unc-93(e1500). Suppressed by intragenic revertants and unc-93 alleles.
MT2147 C. elegans lin-8(n111) II; unc-93(e1500) lin-9(n112) III. Show Description
Rubberband Unc. Muv.