Search Strains

mScarlet replacement of mir-61 and mir-250 pre-miRNAs.

mScarlet replacement of mir-61 and mir-250 pre-miRNAs. SEC has been removed, leaving the SL1::EGL-13NLS::lox2272::mScarlet-I::cMycNLS::let-858 3'UTR transcriptional reporter in the locus

mScarlet replacement of mir-61 and mir-250 pre-miRNAs. SEC and mScarlet-I have been removed

Deletion of mir-266 pre-miRNA. A cassette containing mScarlet-I and an SEC flanked by lox2272 was introduced into the mir-266 loci using CRISPR/Cas9. This line was generated by excising mScarlet-I and the SEC leaving a SL1::EGL13NLS::lox2272 scar.

mScarlet replacement of mir-266 pre-miRNA. A cassette containing mScarlet-I and an SEC flanked by lox2272 was introduced into the mir-266 loci using CRISPR/Cas9. This line was generated by excising SEC leaving the SL1::EGL13NLS::mScarlet-I::cMycNLS::let-858 3' UTR transcriptional reporter in the loci.

Deletion of mir-271 pre-miRNA. A cassette containing mScarlet-I and an SEC flanked by lox2272 was introduced into the mir-271 loci using CRISPR/Cas9. This line was generated by excising mScarlet-I and the SEC leaving a SL1::EGL13NLS::lox2272 scar.

mScarlet replacement of mir-271 pre-miRNA. A cassette containing mScarlet-I and an SEC flanked by lox2272 was introduced into the mir-271 loci using CRISPR/Cas9. This line was generated by excising SEC leaving the SL1::EGL13NLS::mScarlet-I::cMycNLS::let-858 3' UTR transcriptional reporter in the loci.

Deletion of mir-784 pre-miRNA. A cassette containing mScarlet-I and an SEC flanked by lox2272 was introduced into the mir-784 loci using CRISPR/Cas9. This line was generated by excising mScarlet-I and the SEC leaving a SL1::EGL13NLS::lox2272 scar.

mScarlet replacement of mir-784 pre-miRNA. A cassette containing mScarlet-I and an SEC flanked by lox2272 was introduced into the mir-784 loci using CRISPR/Cas9. This line was generated by excising SEC leaving the SL1::EGL13NLS::mScarlet-I::cMycNLS::let-858 3' UTR transcriptional reporter in the loci.

Deletion of mir-787 pre-miRNA. A cassette containing mScarlet-I and an SEC flanked by lox2272 was introduced into the mir-787 loci using CRISPR/Cas9. This line was generated by excising mScarlet-I and the SEC leaving a SL1::EGL13NLS::lox2272 scar.

mScarlet replacement of mir-787 pre-miRNA. A cassette containing mScarlet-I and an SEC flanked by lox2272 was introduced into the mir-787 loci using CRISPR/Cas9. This line was generated by excising SEC leaving the SL1::EGL13NLS::mScarlet-I::cMycNLS::let-858 3' UTR transcriptional reporter in the loci.

Nuclear mScarlet-I was inserted in place of the endogenous mir-788 pre-miRNA via CRISPR/CAS9. Left Flanking: TCTGTGCGTATTACAAATTTTCAGCTGGAA, Right Flanking: GAATAGCAGTTTTCAAAATTGTGAGTTGCT. sgRNA: CTGCAAATGGAAGTTAGAAG.

Nuclear mScarlet-I was inserted in place of the endogenous mir-799 pre-miRNA via CRISPR/CAS9. Left Flanking: ATTTTCTATTTATTGGTATAAAATATGTTA, Right Flanking: AAGAAGTACACTTCATATGCTCCTAACAAT. sgRNA: GTGAACCCTGATAAAGCTAG.

umnIs33 [myo-2p::GFP + NeoR, II: 11755713 (intergenic)] II. Weak-nuclear mScarlet-I was inserted in place of the endogenous lin-4 pre-miRNA via CRISPR/CAS9. Heterozygotes are Rol+, mScarlet+ GFP+, and segregate Rol+ mScarlet+ GFP+, Lin-4 Rol mScarlet+ non-GFP (umn80 homozygotes), and Dpy non-mScarlet GFP+ (mIn1 homozygotes). Maintain by picking wild-type mScarlet+ GFP+. Left Flanking: AGAGTTTTGGTTGGTTTATGAGTTT, Right Flanking: CCAGGACGGTTTGAGCAGATCtttt. sgRNA: TGAGGTCTCAGGGAACAGGC.

umnIs33 [myo-2p::GFP + NeoR, II: 11755713 (intergenic)] II. Nuclear mScarlet-I was inserted in place of the endogenous lin-4 pre-miRNA via CRISPR/CAS9. Heterozygotes are wild-type mScarlet+ GFP+, and segregate wild-type mScarlet+ GFP+, Lin-4 mScarlet+ non-GFP (umn81 homozygotes), and Dpy non-mScarlet GFP+ (mIn1 homozygotes). Maintain by picking wild-type mScarlet+ GFP+. Left Flanking: AGAGTTTTGGTTGGTTTATGAGTTT, Right Flanking: CCAGGACGGTTTGAGCAGATCtttt. sgRNA: TGAGGTCTCAGGGAACAGGC.

umnIs33 [myo-2p::GFP + NeoR, II: 11755713 (intergenic)] II. Weak-nuclear mScarlet-I was inserted in place of the endogenous lin-4 pre-miRNA via CRISPR/CAS9. Heterozygotes are Rol+, mScarlet+ GFP+, and segregate Rol+ mScarlet+ GFP+, Lin-4 Rol mScarlet+ non-GFP (umn83 homozygotes), and Dpy non-mScarlet GFP+ (mIn1 homozygotes). Maintain by picking wild-type mScarlet+ GFP+. Left Flanking: AGAGTTTTGGTTGGTTTATGAGTTT, Right Flanking: CCAGGACGGTTTGAGCAGATCtttt. sgRNA: TGAGGTCTCAGGGAACAGGC.

umnIs33 [myo-2p::GFP + NeoR, II: 11755713 (intergenic)] II. Nuclear mScarlet-I was inserted in place of the endogenous lin-4 pre-miRNA via CRISPR/CAS9. Heterozygotes are wild-type mScarlet+ GFP+, and segregate wild-type mScarlet+ GFP+, Lin-4 mScarlet+ non-GFP (umn84 homozygotes), and Dpy non-mScarlet GFP+ (mIn1 homozygotes). Maintain by picking wild-type mScarlet+ GFP+. Left Flanking: AGAGTTTTGGTTGGTTTATGAGTTT, Right Flanking: CCAGGACGGTTTGAGCAGATCtttt. sgRNA: TGAGGTCTCAGGGAACAGGC.

Nuclear mScarlet-I was inserted in place of the endogenous mir-82 pre-miRNA via CRISPR/CAS9. Left Flanking: TATCATTCTCTCTACTACTAGTGAACTCAT, Right Flanking: TTATCAAGAAAATTCAAGAAAATTCAAAAG. sgRNA: CTGTAGATCACAGAGAAAAC.

Deletion of mir-35, mir-36, mir-37, mir-38, mir-39 and mir-40 miRNA. A cassette containing mScarlet-I and an SEC flanked by lox2272 was introduced into the mir-35 loci using CRISPR/Cas9. This line was generated by excising mScarlet-I and the SEC leaving a SL1::EGL13NLS::lox2272 scar. Left Flanking: CCTCTCCTAATTTCCATTCCCAACTATTAT, Right Flanking: GCTCTTTTTTTGCTGTTTTTAAACTTAAAC. sgRNA #1: ACTGTGGAAGAAACCAGCAA. sgRNA #2: GGTGAAAAATCACCTAGGTC.

Nuclear mScarlet-I was inserted in place of the endogenous mir-35, mir-36, mir-37, mir-38, mir-39 and mir-40 miRNAs via CRISPR/CAS9. Left Flanking: CCTCTCCTAATTTCCATTCCCAACTATTAT, Right Flanking: GCTCTTTTTTTGCTGTTTTTAAACTTAAAC. sgRNA #1: ACTGTGGAAGAAACCAGCAA. sgRNA #2: GGTGAAAAATCACCTAGGTC.

tmIs1240 [myo-2p::venus, X: F23D12.4] X. Deletion of mir-1829.1 pre-miRNA. A cassette containing mScarlet-I and an SEC flanked by lox2272 was introduced into the mir-1829.1 loci using CRISPR/Cas9. This line was generated by excising mScarlet-I and the SEC leaving a SL1::EGL13NLS::lox2272 scar. Heterozygotes are wild-type GFP+ and segregate wild-type GFP+ heterozygotes, non-GFP arrested larvae (umn88 homozygotes) and Mec(Unc) GFP+ (tmC24 homozygotes). Maintain by picking wild-type GFP+. Left Flanking: TGCTAAATCCTTTGTTCAGTTATTATAAGT, Right Flanking: ACATTTTTGGATTGGCAAAGTTGTAGTACT. sgRNA: GTTCAGTTATTATAAGTAAG.

tmIs1240 [myo-2p::venus, X: F23D12.4] X. Nuclear mScarlet-I was inserted in place of the endogenous mir-1829.1 pre-miRNA via CRISPR/CAS9. No mScarlet-I expression is seen under standard growh conditions. Heterozygotes are wild-type GFP+ and segregate wild-type GFP+ heterozygotes, non-GFP umn88 homozygotes (arrest stage/phenotype undertemined) and Mec(Unc) GFP+ (tmC24 homozygotes). Maintain by picking wild-type GFP+. Left Flanking: TGCTAAATCCTTTGTTCAGTTATTATAAGT, Right Flanking: ACATTTTTGGATTGGCAAAGTTGTAGTACT. sgRNA: GTTCAGTTATTATAAGTAAG.

umnIs33 [myo-2p::GFP + NeoR, II: 11755713 (intergenic)] II. lin-4 deletion allele in which lin-4 pre-miRNA (II, lin4:5902254..5902347) was replaced by mScarlet. Heterozygotes are GFP+ mScarlet+ Rollers, and segregate GFP+ mScarlet+ Rollers, non-GFP mScarlet+ lin-4 homozygotes, and Dpy GFP+ mIn1 homozygotes. Maintain by picking wild-type GFP+ mScarlet+ and check for correct segregation of progeny to maintain. Generated in parental strain N2. [NOTE: Low levels of Cre activity can lead to excision of the SEC, causing the strain to lose the Roll phentoype. Pick Rollers to retain full transgene cassette.]

umnIs33 [myo-2p::GFP + NeoR, II: 11755713 (intergenic)] II. lin-4 deletion allele in which lin-4 pre-miRNA (II, lin4:5902254..5902347) was replaced by mScarlet with SL1 (short sequence). Heterozygotes are GFP+ mScarlet+ Rollers, and segregate GFP+ mScarlet+ Rollers, non-GFP mScarlet+ lin-4 homozygotes, and Dpy GFP+ mIn1 homozygotes. Maintain by picking wild-type GFP+ mScarlet+ and check for correct segregation of progeny to maintain. Generated in parental strain N2. [NOTE: Low levels of Cre activity can lead to excision of the SEC, causing the strain to lose the Roll phentoype. Pick Rollers to retain full transgene cassette.]

Increase in apoptotic nuclei and defective in RAD-51 removal. Decreased number of offspring.

dvIs27 [myo-3p::A-Beta (1-42)::let-851 3'UTR) + rol-6(su1006)] X. Rollers. Temperature sensitive: needs to be propagated at 15C. Upshift larval animals to check that the worms get paralyzed and give offspring that arrest as eggs/early larvae. This strain produces low levels of beta amyloid peptide even when grown at low temperature, and therefore there is always some selection for loss of transgene copies. It is recommended to maintain growing stock plates at 15-16 degrees C by transferring small numbers of animals each generation rather than by "chunking", which increases the effective population size and therefore the chance of a relatively rare transgene loss, and then this revertant taking over the population. The strain should also be frozen shortly after being received. This strain can only be sent to academic users and not to commercial organizations. [NOTE: The temperature-sensitive allele cc546 causes an M1957L change in SMG-1. The lesion is an atg>ttg transversion in exon 35. Flanking sequences follow with the mutation site indicated with a capital A: ttggtggtcggttacaaaacgatattcaaga tcactggcagtcatgagtAtggttggatcagttttaggactcggtgatcg acatttggacaatttattg The lesion is detectable via SNP-snip with the mutation causing loss of an MslI site. Primers are for a 323 bp product. Digest with MslI to 86+237 in the wild type, uncut as 323 in the mutant. DJR701(f): CAGTCGTGAGCTTTGGATGCGTGC DJR702(r): TCGGGGATACGCAGATTCTTTCCC. Pedone ... Reiner G3 (2021).]

dvIs19 [(pAF15) gst-4p::GFP::NLS] III. dvIs27 [myo-3p::A-Beta (1-42)::let-851 3'UTR) + rol-6(su1006)] X. Roller with weak constitutive GFP expression. Balanced strain, segregates Rol Uncs [skn-1(zu67) heterozygotes], Rol nonUncs [skn-1(zu67) homozygotes] and dead eggs. Maintain by picking Rol Uncs. Paralyzed if upshifted as larvae to 25C. References: Dostal, V and Link CD (2010) J Vis Exp. Oct 9;(44). Dostal V, Roberts CM, Link CD (2010) Genetics Nov;186(3):857-66. [NOTE: The temperature-sensitive allele cc546 causes an M1957L change in SMG-1. The lesion is an atg>ttg transversion in exon 35. Flanking sequences follow with the mutation site indicated with a capital A: ttggtggtcggttacaaaacgatattcaaga tcactggcagtcatgagtAtggttggatcagttttaggactcggtgatcg acatttggacaatttattg The lesion is detectable via SNP-snip with the mutation causing loss of an MslI site. Primers are for a 323 bp product. Digest with MslI to 86+237 in the wild type, uncut as 323 in the mutant. DJR701(f): CAGTCGTGAGCTTTGGATGCGTGC DJR702(r): TCGGGGATACGCAGATTCTTTCCC. Pedone ... Reiner G3 (2021).]

zaEx5 [let-7::GFP + rol-6(su1006)]. Pick GFP+ to maintain. The GFP+ animals may not always express the Roller phenotype.

muIs32 [mec-7p::GFP + lin-15(+)]. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP nmat-2(ju1514) homozygotes (sterile adults). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. Reference: Kim KW, et al. Elife. 2018 Nov 21;7:e39756. doi: 10.7554/eLife.39756. PMID: 30461420

Heterozygotes are WT and segregate WT, Vul and lethal twitchers. Lethal early larval. Pick twitchers in 1% nicotine.

olaIs138 [ttx-3p::SL2::HYlight::let-858 3'UTR + elt-7p::mCherry] IV. Expression of HYlight, a codon-optimized biosensor that responds to changing levels of FBP in cells, in the neuron pair AIY. Derived by UV/TMP insertion of the olaEx5367 transgene. Reference: Wolfe AD, et al. Proc Natl Acad Sci U S A. 2024 Jan 16;121(3):e2314699121. doi: 10.1073/pnas.2314699121. PMID: 38198527.

Temperature sensitive embryonic lethal. Grows at 15C, 20C. Lethal at 25C (embryonic). See also CGC 1806.

wrdSi22 [eft-3p::TIR1::F2A::mTagBFP::tbb2 3' UTR::SEC[LoxP + let-858 term + sqt-1(d) + hs::Cre + hygR + unc-54 term + LoxP]] I. wrdSi22 is inserted at ttTi4348 (-5.32 cM). Pick Rollers to maintain animals retaining the SEC in the insertion. SEC can be removed by heat shock-induced excision according to the protocol in Dickinson et. al. Genetics 2015. Pan-somatic expression of TIR1 co-factor for AID, and expression of AID*-tagged blue protein in somatic nuclei. Auxin-inducible degradation (AID*) tag inserted at N-terminus of endogenous unc-52 locus by CRISPR/Cas9. References: Cahoon CK, Libuda DE. G3 (Bethesda). 2021 Oct 19;11(11):jkab310. doi: 10.1093/g3journal/jkab310. PMID: 34534266; PMCID: PMC8527506. Ashley GE, et al. Genetics. 2021 Mar 31;217(3):iyab006. doi: 10.1093/genetics/iyab006. PMID: 33677541

Heterozygotes are WT and segregate WT, paralyzed Dpys and lethals.

bmdSi15 [loxN + eef-1A.1p::GFP(1-10)::unc-54 3′ UTR + let-858 terminator + myo-2p::mCherry::3xHA::tbb-2 3′ UTR + loxP] I. bmdSi15 is a CRISPR-based integration into the ttTi4348 site (I:-5.32). Somatic expression of sfGFP(1-10) driven by the eft-3 promoter. CRISPR/Cas9-mediated recombination was used to insert eef-1a.1p::GFP into the standard MosSCI insertion site ttTi4348. Reference: Reference: Costa DS, et al. Development. 2023 May 1;150(9):dev201570. doi: 10.1242/dev.201570. PMID: 37039075.

Heterozygotes are WT and segregate WT, Lethal Twitchers, and dead eggs. Lethal mid-larval (leaky). Maintain by picking WT. Heterozygotes twitch in 1% nicotine.

Heterozygotes are WT and segregate WT, dead eggs and Twitchers that arrest as larvae. Maintain by picking WT. Hets twitch in 1% nicotine.

Heterozygotes are WT and segregate WT, DpyUnc, and Lethal Unc-4 (lethal mid-larval). Maintain by picking WT.

Heterozygotes are WT and segregate WT, DpyUnc [mIn1(mc6) homozygotes], and two-fold arrest Let Rol progeny. Well balanced. Male stock. Cross WT males to WT hermaphrodites and check for correct segregation of progeny.

Dark-bodied, unmarked variant of mIn19mC6) with small broods. Presumably balances let-552 to rol-1 (hermaphrodite stock obtained from outcrossing these males to dpy-10 unc-4 was shown to balance this interval). Isolated from DR1982 as a stock that no longer segregated Dpy-10 animals. Not clear whether this strain is the result of chromosome rearrangement in DR1982, or if DR1982 stock was a mixture of mIn1(+)/mIn[dpy-10] and mIn1(+) homozygotes.

Heterozygotes are WT and segregate WT, Lethal Rollers (arrested 2-fold hatchlings), and Unc-4 mIn1(mC6) homozygotes. Pick WT and check for correct segregation of progeny.

Heterozygotes are WT and segregate WT, Lethal Uncs and Roller mIn1 homozygotes. let-552 unc-4 chromosome is well balanced. Rol does not express until late L4/early adult. Pick WT and check for correct segregation of progeny.

Heterozygotes are WT and segregate WT, DpyRol mIn1 homozygotes and 2-fold arrest Unc larvae. Male stock; mate WT males and WT hermaphrodites to maintain.

Heterozygotes are semi-Dpy and segregate semi-Dpy, Unc, and DpyLet.

Heterozygotes are semi-Dpy and segregate semi-Dpy, Unc and DpyLet. The DpyLets are sterile adults. Maintain by picking semi-Dpy.

Heterozygotes are semi-Dpy and segregate semi-Dpy, Unc and DpyLets. Lethal mid-larval. Maintain by picking semi-Dpy.

Heterozygotes are semi-Dpy and segregate semi-Dpy, Unc and DpyLet. The DpyLets are adult steriles. Maintain by picking semi-Dpy.

Heterozygotes are semi-Dpy and segregate semi-Dpy, Unc and DpyLet. The DpyLet are adult steriles. Maintain by picking semi-Dpy.

Heterozygotes are semi-Dpy and segregate semi-Dpy, Unc, and DpyLets. Lethal early larval. Maintain by picking semi-Dpy.

Heterozygotes are semi-Dpy and segregate semi-Dpy, Unc and DpyLet. Lethal early larval. Maintain by picking semi-Dpy.