| AML499 |
C.elegans |
wtfIs46; wtfIs465. Show Description
wtfIs46 [mec-4p::Chrimson::SL2::mCherry::unc-54 3'UTR]. wtfIs465 [lim-4p::gtACR2::SL2::eGFP::unc-54 3' UTR + unc-122::RFP]. Transgenic animals express light-gated ion channel Chrimson and mCherry in mechanosensory neurons, and light-gated ion channel gtACR2 and eGFP in turning associated neurons RIV, SMB and SAA. RFP expression in coelomocytes. Reference: Kumar S, et al. PLoS Biol. 2023 Sep 21;21(9):e3002280. doi: 10.1371/journal.pbio.3002280. PMID: 37733772.
|
|
| AML597 |
C. elegans |
lgc-47(sy1501) X; wtfIs46. Show Description
wtfIs46 [mec-4p::Chrimson::SL2::mCherry::unc-54 3'UTR]. Expression of activating opsin molecule Chrimson in six gentle-touch mechanosensory neurons (ALML/R, AVM, PLML/R, PVM). Reference: Kumar S, et al. An inhibitory acetylcholine receptor gates context dependent mechanosensory processing in C. elegans. bioRxiv 2024.03.21.586204; doi: https://doi.org/10.1101/2024.03.21.586204. PMID: 38585821.
|
|
| AML614 |
C. elegans |
lgc-47(sy1501) X; wtfIs46; wtfEx535. Show Description
wtfIs46 [mec-4p::Chrimson::SL2::mCherry::unc-54 3'UTR]. wtfEx535 [tdc-1p::AI::lgc-
47::SL2::his-24::tagRFP + unc-122p::GFP]. Pick animals with GFP+ coelomocytes to maintain. Expression of activating opsin molecule Chrimson in six gentle-touch mechanosensory neurons (ALML/R, AVM, PLML/R, PVM). Rescuing LGC-47 expression in RIML/R neurons. Reporter construct contains an artificial intron (AI). Reference: Kumar S, et al. An inhibitory acetylcholine receptor gates context dependent mechanosensory processing in C. elegans. bioRxiv 2024.03.21.586204; doi: https://doi.org/10.1101/2024.03.21.586204. PMID: 38585821.
|
|
| AML617 |
C. elegans |
lgc-47(sy1501) X; wtfIs46; wtfEx538. Show Description
wtfIs46 [mec-4p::Chrimson::SL2::mCherry::unc-54 3'UTR]. wtfEx538 [npr-9p::AI::lgc-47::SL2::tagBFP + unc-122p::GFP]. Pick animals with GFP+ coelomocytes to maintain. Expression of activating opsin molecule Chrimson in six gentle-touch mechanosensory neurons (ALML/R, AVM, PLML/R, PVM). Rescuing LGC-47 expression in AIB neuron. Reporter construct contains an artificial intron (AI). Reference: Kumar S, et al. An inhibitory acetylcholine receptor gates context dependent mechanosensory processing in C. elegans. bioRxiv 2024.03.21.586204; doi: https://doi.org/10.1101/2024.03.21.586204. PMID: 38585821.
|
|
| AML618 |
C. elegans |
lgc-47(sy1501) X; wtfIs46; wtfEx539. Show Description
wtfIs46 [mec-4p::Chrimson::SL2::mCherry::unc-54 3'UTR]. wtfEx539 [rig-3p::AI::lgc-47::SL2::GFP + unc-122p::GFP]. Pick animals with GFP+ coelomocytes to maintain. Expression of activating opsin molecule Chrimson in six gentle-touch mechanosensory neurons (ALML/R, AVM, PLML/R, PVM). Rescuing LGC-47 expression in AVA neuron. Reporter construct contains an artificial intron (AI). Reference: Kumar S, et al. An inhibitory acetylcholine receptor gates context dependent mechanosensory processing in C. elegans. bioRxiv 2024.03.21.586204; doi: https://doi.org/10.1101/2024.03.21.586204. PMID: 38585821.
|
|
| AML622 |
C. elegans |
lgc-47(sy1501) X; wtfIs46; wtfEx543. Show Description
wtfIs46 [mec-4p::Chrimson::SL2::mCherry::unc-54 3'UTR]. wtfEx543 [tdc-1p::AI::lgc-47::SL2::his-24::tagRFP + npr-9p::AI::lgc-47::SL2::tagBFP + rig-3p::AI::lgc-47::SL2::GFP + unc-122p::GFP]. Pick animals with GFP+ coelomocytes to maintain. Expression of activating opsin molecule Chrimson in six gentle-touch mechanosensory neurons (ALML/R, AVM, PLML/R, PVM). Rescuing LGC-47 expression in AIB, AVA,
and RIM neurons. Reporter construct contains an artificial intron (AI). Reference: Kumar S, et al. An inhibitory acetylcholine receptor gates context dependent mechanosensory processing in C. elegans. bioRxiv 2024.03.21.586204; doi: https://doi.org/10.1101/2024.03.21.586204. PMID: 38585821.
|
|
| AML627 |
C. elegans |
acc-1 (tm3268) IV; wtfIs46. Show Description
wtfIs46 [mec-4p::Chrimson::SL2::mCherry::unc-54 3'UTR]. Expression of activating opsin molecule Chrimson in six gentle-touch mechanosensory neurons (ALML/R, AVM, PLML/R, PVM). Reference: Kumar S, et al. An inhibitory acetylcholine receptor gates context dependent mechanosensory processing in C. elegans. bioRxiv 2024.03.21.586204; doi: https://doi.org/10.1101/2024.03.21.586204. PMID: 38585821.
|
|
| AML659 |
C. elegans |
acc-1(tm3268) IV; lgc-47(sy1501) X; wtfIs46. Show Description
wtfIs46 [mec-4p::Chrimson::SL2::mCherry::unc-54 3'UTR]. mec-4 promoter drives expression of activating opsin molecule Chrimson and fluorescent protein mCherry in six gentle-touch mechanosensory neurons (ALML/R, AVM, PLML/R, PVM). Reference: Kumar S, et al. An inhibitory acetylcholine receptor gates context dependent mechanosensory processing in C. elegans. (2024) iScience. https://www.sciencedirect.com/science/article/pii/S2589004224020017 PMID: 38585821.
|
|
| AML67 |
C. elegans |
wtfIs46. Show Description
wtfIs46 [mec-4p::Chrimson::SL2::mCherry::unc-54 3'UTR]. Transgenic animals express light-gated ion channel Chrimson and mCherry in mechanosensory neurons. Reference: Liu M, et al. eLife 2018;7:e36419 DOI: 10.7554/eLife.36419.
|
|
| BC964 |
C. elegans |
let-56(s46) unc-22(s7)/unc-5(e152) dpy-4(e1166) IV. Show Description
Heterozygotes are WT and segregate more WT, DpyUncs and Lethal Twitchers. Lethal late larval. Heterozygotes Twitch in 1% Nicotine. Pick WT to maintain.
|
|
| CGC60 |
C. elegans |
dpy-18(e364)/eT1 III; unc-46(e177)/eT1[umnIs46] V. Show Description
umnIs46 [myo-2p::mKate2 + NeoR, III:9421936 (intergenic)] V. Heterozygotes are wild-type mKate+, and segregate wild-type mKate2+, Unc-36 mKate+ (eT1), dead eggs, and DpyUncs. Maintain by picking wild-type mKate2+. Derived by insertion of myo-2p::mKate2 transgene into eT1 balancer in parental strain BC2200 using CRISPR/Cas9.
|
|
| EG7477 |
C. elegans |
syIs46 II; unc-119(ed3) III; oxTi483 X. Show Description
syIs46 [hsp16p::GFP-LacI; dpy-30p::S65TGFP; dpy-20(+)], oxTi483 [256xLacO + Cbr-unc-119(+) + PuroR]. MiniMos plasmid (pCFJ797) with 256x LacO, Cbr-unc-119(+) and PuroR inserted into syIs46 II; unc-119(ed3) III strain derived from PS2958. May still contain ncl-1 (e1865) III, him-5(e1490)V or dpy-20(e1282ts) IV from PS2958. Puro resistance verified.
|
|
| EG7478 |
C. elegans |
syIs46 II; unc-119(ed3) III; oxTi487 X. Show Description
syIs46 [hsp16p::GFP-LacI; dpy-30p::S65TGFP; dpy-20(+)], oxTi487 [256xLacO + Cbr-unc-119(+) + PuroR]. MiniMos plasmid (pCFJ797) with 256x LacO, Cbr-unc-119(+) and PuroR inserted into syIs46 II; unc-119(ed3) III strain derived from PS2958. May still contain ncl-1 (e1865) III, him-5(e1490)V or dpy-20(e1282ts) IV from PS2958. Puro resistance verified.
|
|
| EG7522 |
C. elegans |
syIs46 II; oxTi467 unc-119(ed3) III. Show Description
syIs46 [hsp16p::GFP-LacI; dpy-30p::S65TGFP; dpy-20(+)], oxTi467 [256xLacO + Cbr-unc-119(+) + NeoR]. MiniMos plasmid (pCFJ796) with 256x LacO, Cbr-unc-119(+) and NeoR inserted into syIs46 II; unc-119(ed3) III strain derived from PS2958. May still contain ncl-1 (e1865) III, him-5(e1490)V or dpy-20(e1282ts) IV from PS2958. Neo resistance verified.
|
|
| EG7523 |
C. elegans |
oxTi468 I; syIs46 II; unc-119(ed3) III. Show Description
syIs46 [hsp16p::GFP-LacI; dpy-30p::S65TGFP; dpy-20(+)], oxTi468 [256xLacO + Cbr-unc-119(+) + NeoR]. MiniMos plasmid (pCFJ796) with 256x LacO, Cbr-unc-119(+) and NeoR inserted into syIs46 II; unc-119(ed3) III strain derived from PS2958. May still contain ncl-1 (e1865) III, him-5(e1490)V or dpy-20(e1282ts) IV from PS2958. Neo resistance verified.
|
|
| EG7524 |
C. elegans |
syIs46 II; unc-119(ed3) III; oxTi469 IV. Show Description
syIs46 [hsp16p::GFP-LacI; dpy-30p::S65TGFP; dpy-20(+)], oxTi469 [256xLacO + Cbr-unc-119(+) + NeoR]. MiniMos plasmid (pCFJ796) with 256x LacO, Cbr-unc-119(+) and NeoR inserted into syIs46 II; unc-119(ed3) III strain derived from PS2958. May still contain ncl-1 (e1865) III, him-5(e1490)V or dpy-20(e1282ts) IV from PS2958. Neo resistance verified.
|
|
| EG7525 |
C. elegans |
oxTi470 syIs46 II; unc-119(ed3) III. Show Description
syIs46 [hsp16p::GFP-LacI; dpy-30p::S65TGFP; dpy-20(+)], oxTi470 [256xLacO + Cbr-unc-119(+) + PuroR]. MiniMos plasmid (pCFJ797) with 256x LacO, Cbr-unc-119(+) and PuroR inserted into syIs46 II; unc-119(ed3) III strain derived from PS2958. May still contain ncl-1 (e1865) III, him-5(e1490)V or dpy-20(e1282ts) IV from PS2958. Puro resistance verified.
|
|
| EG7526 |
C. elegans |
oxTi471 syIs46 II; unc-119(ed3) III. Show Description
syIs46 [hsp16p::GFP-LacI; dpy-30p::S65TGFP; dpy-20(+)], oxTi471 [256xLacO + Cbr-unc-119(+) + PuroR]. MiniMos plasmid (pCFJ797) with 256x LacO, Cbr-unc-119(+) and PuroR inserted into syIs46 II; unc-119(ed3) III strain derived from PS2958. May still contain ncl-1 (e1865) III, him-5(e1490)V or dpy-20(e1282ts) IV from PS2958. Puro resistance verified.
|
|
| EG7527 |
C. elegans |
oxTi472 syIs46 II; unc-119(ed3) III. Show Description
syIs46 [hsp16p::GFP-LacI; dpy-30p::S65TGFP; dpy-20(+)], oxTi472 [256xLacO + Cbr-unc-119(+) + PuroR]. MiniMos plasmid (pCFJ797) with 256x LacO, Cbr-unc-119(+) and PuroR inserted into syIs46 II; unc-119(ed3) III strain derived from PS2958. May still contain ncl-1 (e1865) III, him-5(e1490)V or dpy-20(e1282ts) IV from PS2958. Puro resistance verified.
|
|
| EG7528 |
C. elegans |
oxTi473 syIs46 II; unc-119(ed3) III. Show Description
syIs46 [hsp16p::GFP-LacI; dpy-30p::S65TGFP; dpy-20(+)], oxTi473 [256xLacO + Cbr-unc-119(+) + PuroR]. MiniMos plasmid (pCFJ797) with 256x LacO, Cbr-unc-119(+) and PuroR inserted into syIs46 II; unc-119(ed3) III strain derived from PS2958. May still contain ncl-1 (e1865) III, him-5(e1490)V or dpy-20(e1282ts) IV from PS2958. Puro resistance verified.
|
|
| EG7529 |
C. elegans |
syIs46 II; unc-119(ed3) III; oxTi474 V. Show Description
syIs46 [hsp16p::GFP-LacI; dpy-30p::S65TGFP; dpy-20(+)], oxTi474 [256xLacO + Cbr-unc-119(+) + PuroR]. MiniMos plasmid (pCFJ797) with 256x LacO, Cbr-unc-119(+) and PuroR inserted into syIs46 II; unc-119(ed3) III strain derived from PS2958. May still contain ncl-1 (e1865) III, him-5(e1490) V or dpy-20(e1282ts) IV from PS2958. Puro resistance verified.
|
|
| EG7530 |
C. elegans |
syIs46 II; unc-119(ed3) III; oxTi475 V. Show Description
syIs46 [hsp16p::GFP-LacI; dpy-30p::S65TGFP; dpy-20(+)], oxTi475 [256xLacO + Cbr-unc-119(+) + PuroR]. MiniMos plasmid (pCFJ797) with 256x LacO, Cbr-unc-119(+) and PuroR inserted into syIs46 II; unc-119(ed3) III strain derived from PS2958. May still contain ncl-1 (e1865) III, him-5(e1490)V or dpy-20(e1282ts) IV from PS2958. Puro resistance verified.
|
|
| EG7531 |
C. elegans |
syIs46 II; unc-119(ed3) III; oxTi476 V. Show Description
syIs46 [hsp16p::GFP-LacI; dpy-30p::S65TGFP; dpy-20(+)], oxTi476 [256xLacO + Cbr-unc-119(+) + PuroR]. MiniMos plasmid (pCFJ797) with 256x LacO, Cbr-unc-119(+) and PuroR inserted into syIs46 II; unc-119(ed3) III strain derived from PS2958. May still contain ncl-1 (e1865) III, him-5(e1490)V or dpy-20(e1282ts) IV from PS2958. Puro resistance verified.
|
|
| EG7532 |
C. elegans |
syIs46 II; unc-119(ed3) III; oxTi477 IV. Show Description
syIs46 [hsp16p::GFP-LacI; dpy-30p::S65TGFP; dpy-20(+)], oxTi477 [256xLacO + Cbr-unc-119(+) + PuroR]. MiniMos plasmid (pCFJ797) with 256x LacO, Cbr-unc-119(+) and PuroR inserted into syIs46 II; unc-119(ed3) III strain derived from PS2958. May still contain ncl-1 (e1865) III, him-5(e1490)V or dpy-20(e1282ts) IV from PS2958. Puro resistance verified.
|
|
| EG7533 |
C. elegans |
syIs46 II; unc-119(ed3) III; oxTi478 V. Show Description
syIs46 [hsp16p::GFP-LacI; dpy-30p::S65TGFP; dpy-20(+)], oxTi478 [256xLacO + Cbr-unc-119(+) + PuroR]. MiniMos plasmid (pCFJ797) with 256x LacO, Cbr-unc-119(+) and PuroR inserted into syIs46 II; unc-119(ed3) III strain derived from PS2958. May still contain ncl-1 (e1865) III, him-5(e1490)V or dpy-20(e1282ts) IV from PS2958. Puro resistance verified.
|
|
| EG7534 |
C. elegans |
oxTi480 syIs46 II; unc-119(ed3) III. Show Description
syIs46 [hsp16p::GFP-LacI; dpy-30p::S65TGFP; dpy-20(+)], oxTi480 [256xLacO + Cbr-unc-119(+) + PuroR]. MiniMos plasmid (pCFJ797) with 256x LacO, Cbr-unc-119(+) and PuroR inserted into syIs46 II; unc-119(ed3) III strain derived from PS2958. May still contain ncl-1 (e1865) III, him-5(e1490)V or dpy-20(e1282ts) IV from PS2958. Puro resistance verified.
|
|
| EG7535 |
C. elegans |
oxTi481 I; syIs46 II; unc-119(ed3) III. Show Description
syIs46 [hsp16p::GFP-LacI; dpy-30p::S65TGFP; dpy-20(+)], oxTi481 [256xLacO + Cbr-unc-119(+) + PuroR]. MiniMos plasmid (pCFJ797) with 256x LacO, Cbr-unc-119(+) and PuroR inserted into syIs46 II; unc-119(ed3) III strain derived from PS2958. May still contain ncl-1 (e1865) III, him-5(e1490)V or dpy-20(e1282ts) IV from PS2958. Puro resistance verified.
|
|
| EG7536 |
C. elegans |
syIs46 II; unc-119(ed3) III; oxTi482 IV. Show Description
syIs46 [hsp16p::GFP-LacI; dpy-30p::S65TGFP; dpy-20(+)], oxTi482 [256xLacO + Cbr-unc-119(+) + PuroR]. MiniMos plasmid (pCFJ797) with 256x LacO, Cbr-unc-119(+) and PuroR inserted into syIs46 II; unc-119(ed3) III strain derived from PS2958. May still contain ncl-1 (e1865) III, him-5(e1490)V or dpy-20(e1282ts) IV from PS2958. Puro resistance verified.
|
|
| EG7538 |
C. elegans |
syIs46 II; unc-119(ed3) oxTi485 III. Show Description
syIs46 [hsp16p::GFP-LacI; dpy-30p::S65TGFP; dpy-20(+)], oxTi485 [256xLacO + Cbr-unc-119(+) + PuroR]. MiniMos plasmid (pCFJ797) with 256x LacO, Cbr-unc-119(+) and PuroR inserted into syIs46 II; unc-119(ed3) III strain derived from PS2958. May still contain ncl-1 (e1865) III, him-5(e1490)V or dpy-20(e1282ts) IV from PS2958. Puro resistance verified.
|
|
| EG7539 |
C. elegans |
syIs46 II; unc-119(ed3) III; oxTi486 V. Show Description
syIs46 [hsp16p::GFP-LacI; dpy-30p::S65TGFP; dpy-20(+)], oxTi486 [256xLacO + Cbr-unc-119(+) + PuroR]. MiniMos plasmid (pCFJ797) with 256x LacO, Cbr-unc-119(+) and PuroR inserted into syIs46 II; unc-119(ed3) III strain derived from PS2958. May still contain ncl-1 (e1865) III, him-5(e1490)V or dpy-20(e1282ts) IV from PS2958. Puro resistance verified.
|
|
| EG7541 |
C. elegans |
oxTi479 I; syIs46 II; unc-119(ed3) III. Show Description
syIs46 [hsp16p::GFP-LacI; dpy-30p::S65TGFP; dpy-20(+)], oxTi479 [256xLacO + Cbr-unc-119(+) + PuroR]. MiniMos plasmid (pCFJ797) with 256x LacO, Cbr-unc-119(+) and PuroR inserted into syIs46 II; unc-119(ed3) III strain derived from PS2958. May still contain ncl-1 (e1865) III, him-5(e1490)V or dpy-20(e1282ts) IV from PS2958. Puro resistance verified.
|
|
| FAS46 |
C. elegans |
his-72 (uge30[gfp::his-72]) III. Show Description
Superficially wild-type. Reference: Delaney K, et al. Genetics. 2018 Apr 10. pii: genetics.300909.2018. doi: 10.1534/genetics.118.300909. [Epub ahead of print].
|
|
| HS886 |
C. elegans |
bet-1(os46) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
Heterozygotes are WT and GFP in the pharynx, and segregate WT GFP+, Sterile Psa(Phasmid socket absent) non-GFP homozygous os46) animals and dead eggs. Maintain by picking GFP progeny. Reference: Shibata et al. Development in press (2010).
|
|
| KS46 |
C. elegans |
lin-44(n1792) I; egl-20(n585) IV. Show Description
|
|
| ML1651 |
C. elegans |
mcIs46. Show Description
mcIs46 [dlg-1::RFP + unc-119(+)]. Superficially Wild-type. Reference: Diogon M, et al., Development. 2007 Jul;134(13):2469-79.
|
|
| NK364 |
C. elegans |
unc-119(ed3) III; qyIs46. Show Description
qyIs46 [emb-9p::emb-9::mCherry + unc-119(+)] X. Superficially wild-type with very low penetrance (~5%) rupture. Integrated collagen::mCherry reporter. Reference: Ihara S, et al. Nat Cell Biol. 2011 Jun;13(6):641-51.
|
|
| PS2958 |
C. elegans |
syIs46 II; ncl-1(e1865) III; dpy-20(e1282) IV; him-5(e1490) V. Show Description
syIs46 [dpy-30::S65T::lacI + hsp-16p::GFP::lacI + dpy-20(+)] II. Animals are Ncl, Him and Non-Dpy. Heat shock results in diffuse nuclear GFP expression from Fire Lab vector pPD49.78::LacI in most cells. Also see some consitutive GFP expression in embryos from dpy-30 promoter. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
|
|
| RB50 |
C. elegans |
okIs46 I. Show Description
okIs46 I. Integrated pharyngeal GFP. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use.
|
|
| RG3225 |
C. elegans |
Y56A3A.19(ve725[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/eT1 III; +/eT1 [umnIs46] V. Show Description
umnIs46 [myo-2p::mKate2 + NeoR, III:9421936 (intergenic)] V. Homozygous larval arrest. Deletion of 682 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate+, and segregate wild-type GFP+ mKate2+ heterozygotes, GFP+ non-mKate2 arrested larvae (ve725 homozygotes), Unc-36 non-GFP mKate+ animals (eT1 homozygotes) and dead eggs (aneuploids). Maintain by picking wild-type GFP+ mKate2+. Left flanking Sequence: tcgcgtcgagacccctaaatctgtgcgcct ; Right flanking sequence: tcgggaaatgactcatcgagcctgaaaaat. sgRNA #1: ttctgatatacttttctcaa; sgRNA #2: aaaaaatttgacgggaaatc. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| TS469 |
C. elegans |
nca-2(gk5) III; unc-77(gk9) IV; lin-15B&lin-15A(n765) X; vaIs46. Show Description
vaIs46 [nca-1::GFP + lin-15(+)]. Superficially Wild-type.
|
|
| TU3135 |
C. elegans |
mec-8(u218) I; rde-1(ne219) V; uIs46. Show Description
uIs46 [rde-1p::mec-2(intron9)::rde-1) + ceh-22::GFP]. Temperature sensitive; maintain at 15 C. RNAi-sensitive at 15 C. Mechanosensory abnormal at 25 C. Uses the ninth intron of mec-2, whose splicing depends on mec-8, to produce temperature-sensitive expression and temperature-sensitive RNAi. Reference: Calixto et al. (2010) Nature Methods 7:407-11.
|
|
| TX691 |
C. elegans |
unc-119(ed3) III; teIs46. Show Description
teIs46 [pRL1417; end-1p::GFP::H2B + unc-119(+)]. Maintain under normal conditions.
|
|
| AML496 |
C.elegans |
wtfIs465. Show Description
wtfIs465 [lim-4p::gtACR2::SL2::eGFP::unc-54 3' UTR + unc-122::RFP]. Transgenic animals express light-gated ion channel gtACR2 and a fluorescent protein eGFP in turning associated neurons RIV, SMB and SAA, alongside RFP in coelomocytes. Reference: Kumar S, et al. PLoS Biol. 2023 Sep 21;21(9):e3002280. doi: 10.1371/journal.pbio.3002280. PMID: 37733772.
|
|
| CZ20132 |
C. elegans |
juSi94 II; rps-18(ok3353) IV; juIs463. Show Description
juSi94 [GFP11::rps-18 + Cbr-unc-119(+)] II. juIs463 [flp-13p::GFP1-10 + ttx-3p::RFP]. DD motor neuron-specific expression of split GFP reporter allows visualization of ribosomes in those neurons. Reference: Noma et al Elife. 2017 Aug 2;6. pii: e26376. doi: 10.7554/eLife.26376.
|
|
| FT1265 |
C. elegans |
sec-5(pk2358) II; xnIs461. Show Description
xnIs461 [sec-5::YFP + unc-119(+)]. Expresses sec-5::YFP maternally and zygotically. Expression is present in many cells, including early embryos, epithelial cells, the excretory cell, and the germ line. Rescues maternal-effect lethality of sec-5(pk2358). Reference: Armenti ST, Chan E, Nance J. Dev Biol. 2014 Aug 4. pii: S0012-1606(14)00355-8.
|
|
| GS460 |
C. elegans |
evl-15(ar126) dpy-20(e1282)/unc-26(e205) IV. Show Description
Heterozygotes are WT and segregate WT, Uncs and DpySteriles with an everted vulva. Recombines. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
|
|
| NK2902 |
C. elegans |
bmdSi15 I; rpl-31(qy189[rpl-31::ZF1::GFP11]) I; zif-1(gk117) III; qyIs463. Show Description
qyIs463 [lin-29p::zif-1::SL2::mCherry]. bmdSi15 [loxN + eef-1A.1p::GFP(1-10)::unc-54 3? UTR + let-858 terminator + myo-2p::mCherry::3xHA::tbb-2 3? UTR + loxP] I. bmdSi15 is a CRISPR-based integration into the ttTi4348 site (I:-5.32). ZF1 and split GFP tag (GFP11) inserted into the C-terminus of the endogenous rpl-31 locus.
|
|
| OP460 |
C. elegans |
unc-119(tm4063) III; wgIs460. Show Description
wgIs460 [nhr-80::TY1::EGFP::3xFLAG(92C12) + unc-119(+)]. TY1::EGFP::3xFLAG tag inserted in frame at C-terminus of coding sequence by recombineering. Expression of transgene confirmed by GFP. References: Sarov, M, et al. Nat Methods (2006) 10:839-44. Zhong, M, et al. PLoS Genet (2010) 6(2):e1000848. Strain was constructed as part of the Regulatory Element Project, part of modENCODE (http://www.modencode.org)
|
|
| OP462 |
C. elegans |
unc-119(tm4063) III; wgIs462. Show Description
wgIs462 [rnt-1::TY1::EGFP::3xFLAG(92C12) + unc-119(+)]. TY1::EGFP::3xFLAG tag inserted in frame at C-terminus of coding sequence by recombineering. Expression of transgene confirmed by GFP. References: Sarov, M, et al. Nat Methods (2006) 10:839-44. Zhong, M, et al. PLoS Genet (2010) 6(2):e1000848. Strain was constructed as part of the Regulatory Element Project, part of modENCODE (http://www.modencode.org)
|
|
| OP463 |
C. elegans |
unc-119(tm4063) III; wgIs463. Show Description
wgIs463 [nhr-102::TY1::EGFP::3xFLAG(92C12) + unc-119(+)]. TY1::EGFP::3xFLAG tag inserted in frame at C-terminus of coding sequence by recombineering. Expression of transgene confirmed by GFP. References: Sarov, M, et al. Nat Methods (2006) 10:839-44. Zhong, M, et al. PLoS Genet (2010) 6(2):e1000848. Strain was constructed as part of the Regulatory Element Project, part of modENCODE (http://www.modencode.org)
|
|