More Fields
Strain Species Genotype
DR721 C. elegans lin-4(e912) II. Show Description
Completely vulvaless. Long. Uncoordinated. Somewhat clear.
VT509 C. elegans lin-4(e912) II; maEx114. Show Description
maEx114 [lin-4(+) + rol-6(su1006)]. Pick Rollers to maintain. lin-4 loss-of-function is rescued by the maEx114 extrachromosomal array expressing lin-4 microRNA. Reference: Lee RC, et al. Cell. 75, 843-854.
CB2627 C. elegans lin-4(e912)/dpy-10(e128) II. Show Description
Heterozygotes are WT and segregate WT, Dpy and Vulvaless. Maintain by picking WT.
MT1538 C. elegans lin-28(n719) I; lin-4(e912) II. Show Description
MT18023 C. elegans lin-4(e912) II; mir-237(n4296) X. Show Description
Reference: Alvarez-Saavedra E, Horvitz HR. (2010) Curr Biol. 20(4):367-73.
MT5790 C. elegans lin-4(e912) II; nIs2 IV. Show Description
nIs2 [lin-11::lacZ + lin-11(+)] IV. Vul. Integrated on IV near dpy-20.
MT862 C. elegans lin-4(e912) II; lin-14(n360) X. Show Description
VT573 C. elegans lin-4(e912) II; lin-14(n179) X. Show Description
lin-14(n179) is temperature-sensitive. lin-4; lin-14 double mutant may be maintained at 20C.
MT3316 C. elegans lin-4(e912)/mnC1 [dpy-10(e128) unc-52(e444)] II. Show Description
CT16 C. elegans zaEx17. Show Description
zaEx17 [lin-4::GFP + rol-6(su1006)]. Pick GFP+ to maintain. The GFP+ animals may not always express the Roller phenotype.
GR1452 C. elegans veIs13 V; let-7(mn112) unc-3(e151) X; mgEx725. Show Description
veIs13 [col-19::GFP + rol-6(su1006)] V. mgEx725 [lin-4::let-7 + ttx-3::RFP]. Pick RFP+ to maintain. mgEx725 rescues lethality of let-7(mn112). Precocious expression of col-19::GFP at the L4 stage. Reference: Hayes GD, Riedel CG, Ruvkun G. 2011. Genes Dev. 2011 Oct 1;25(19):2079-92.
OH16398 C. elegans otIs763. Show Description
otIs763 [lin-4(fosmid)::SL2::YFP::H2B]. Integrated fosmid transcriptional reporter for lin-4 microRNA.
OH16834 C. elegans otTi71. Show Description
otTi71 [UPN::lin-4::unc-54 3Â’UTR]. single copy insertion of panneuronally expressed lin-4 pri-miRNA.
PS4997 C. elegans unc-119(e2498) III; syIs179. Show Description
syIs179 [N2 genomic DNA (45 ng/uL) + unc-119(+) (1 ng/uL) + lin-4p::YFP (PCR fusion) (1 ng/uL)(100:1)]. lin-4 promoter primers: GCGATATTTTGCTCGATTCC, ACAGGCCGGAAGCATAAACT. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
ALF62 C. elegans bafIs62. Show Description
bafIs62 [lin-42p::GFP + unc-119(+)]. lin-42p::GFP reporter consists of 2 kb upstream of lin-42a isoform subcloned into modified pPD95.75 vector also carrying unc-119(+). Reference: Hochbaum D, et al. PLoS Genet. 2011 Jul;7(7):e1002179.
ALF63 C. elegans unc-119(ed3) III; bafIs63. Show Description
bafIs63 [lin-42p(mut)::GFP + unc-119(+)]. lin-42p(mut)::GFP reporter consists of 2 kb upstream of lin-42a isoform subcloned into modified pPD95.75 vector also carrying unc-119(+); all potential DAF-12 binding sites have been mutated. Reference: Hochbaum D, et al. PLoS Genet. 2011 Jul;7(7):e1002179.
ALF82 C. elegans unc-119(ed3) III; daf-12(rh61rh411) X; bafIs62. Show Description
bafIs62 [lin-42p::GFP + unc-119(+)]. lin-42p::GFP reporter consists of 2 kb upstream of lin-42a isoform subcloned into modified pPD95.75 vector also carrying unc-119(+). Array was crossed into strain ALF3 to create ALF82. Reference: Hochbaum D, et al. PLoS Genet. 2011 Jul;7(7):e1002179.
BC3455 C. elegans dpy-18(e364)/eT1 III; lin-40(s1506) unc-46(e177)/eT1 V. Show Description
Heterozygotes are WT and segregate WT, Unc-36, DpyUncLet and dead eggs. Mid-larval lethal. Maintain by picking WT.
BS3347 C. elegans lin-45(dx84) IV/nT1 [unc-?(n754) let-?] (IV;V). Show Description
Heterozygotes are Unc and segregate Unc heterozygotes, non-Unc Steriles (lin-45 homozygotes), larval lethals, and dead eggs. dx84 is a strong lin-45 raf allele: dx84 homozygotes from dx84/+ heterozygotes are 47% larval lethal and among the adults, 100% are Sterile and Vul.
BS5183 C. elegans lin-45(oz201) IV/nT1 [unc-?(n754) let-?] (IV;V). Show Description
Heterozygotes are Unc and segregate Unc, non-Unc Steriles, larval lethals, and dead eggs. oz201 is a strong lin-45 raf allele: oz201 homozygotes from oz201/+ heterozygotes segregate 55% larval lethal and the remaining adults are all Sterile and Vul.
CB4281 C. elegans +/eT1 III; eDf43 dpy-11(e224)/eT1 V. Show Description
eDf43 pka lin-49(e2173). Heterozygotes are WT and segregate WT, Unc-36, and LinDpys. The lin-40 dpy-11 homozygotes are Dpy, Sterile and abnormal. Maintain by picking WT.
CT8 C. elegans lin-41(ma104) I. Show Description
Dpy. Precocious heterochronic. Reduced brood size. There may be a linked Dpy mutation in this strain.
CZ252 C. elegans itr-1(n2559)/lin-45(n2018) unc-24(e138) IV. Show Description
Heterozygotes are WT and segregate WT, Unc Lins and very slow growing constipated worms. n2559 is a null allele of itr-1.
DG3784 C. elegans lin-41(tn1487) I. Show Description
Temperature-sensitive sterile. Maintain at 15C. Reference: Spike CA, et al. Genetics. 2014 Sep 26. pii: genetics.114.168831.
DG3913 C. elegans lin-41(tn1541[GFP::tev::s::lin-41]) I. Show Description
lin-41(tn1541[GFP::tev::s::lin-41]) I. May be maintained under normal conditions.
EJ521 C. elegans lin-45(dx19) IV/nT1 [unc-?(n754) let-?] (IV;V). Show Description
Heterozygotes are Unc and segregate Unc, non-Unc Steriles, larval lethals and dead eggs. dx19 is a strong lin-45 raf allele: dx19 homozygotes from dx19/+ heterozygous parents are 13% larval lethal and among the adults, 100% are Sterile and Vul.
EM101 C. elegans lin-41(bx37) I; him-5(e1490) V. Show Description
Maintain under normal conditions. Males have long tail tips.
EM106 C. elegans lin-41(bx42) I; him-5(e1490) V. Show Description
Maintain under normal conditions. Males have long tail tips.
EW52 C. elegans lin-44(n1792) I; cwn-2(ok895) IV. Show Description
EW53 C. elegans lin-44(n1792) I; cwn-1(ok546) II; cwn-2(ok895) IV. Show Description
EW55 C. elegans dpy-20(e1362) IV; deEx100. Show Description
deEx100 [ajm-1::GFP + HinfI digested complex DNA + lin-44p::4xNLS::GFP + dpy20(+)]. Pick non-Dpy to maintain.
EW68 C. elegans lin-44(n1792) I; cwn-1(ok546) II. Show Description
EW77 C. elegans lin-44(n1792) I; egl-20(n585) IV/nT1 [qIs51] (IV;V); dpy-11(e1180) mom-2(or42) V/nT1 [qIs51] (IV;V). Show Description
FK183 C. elegans daf-11(ks67) V; ksEx29. Show Description
ksEx29 [daf-7::GFP + lin-44::GFP]. Maintain by picking GFP. daf-7::GFP is dark or invisible. lin-44::GFP is bright in the tail. Grows better at 15C.
FX30262 C. elegans lin-42(tmIs1246) II. Show Description
Break points: lin-42 II. Covered region (Mb) (1.2) Balancer marked with myo-2p::Venus. Egl. [NOTE: the genotype originally listed for this strain in Table 2 of Dejima, et al. was incorrect.] Reference: Dejima K, et al. Cell Rep. 2018 Jan 2;22(1):232-241.
FX30266 C. elegans lin-42(tmIs1226) II. Show Description
Break points: lin-42 II. Covered region (Mb) (1.2) Balancer marked with myo-2p::mCherry. tmIs1226 is integrated in the same site as tmIs1246, but Egl phenotype is not detectable. [NOTE: the genotype originally listed for this strain in Table 2 of Dejima, et al. was incorrect.] Reference: Dejima K, et al. Cell Rep. 2018 Jan 2;22(1):232-241.
HS1680 C. elegans lin-44(n1792) zdIs5 I; cwn-1(ok546) II; egl-20(n585) cwn-2(ok895) IV/nT1 [qIs51] (IV;V); mom-2(ne874) V/nT1. Show Description
zdIs5 [mec-4::GFP + lin-15(+)]. Homozygous nT1[qIs51] are inviable. mec-4::GFP is expressed in touch neurons. Heterozygotes are strong Egl Psa GFP+ and segregate dead eggs and non-GFP Unc Egl Psa that give only dead eggs at 25C.
HW1329 C. elegans lin-41(xe11) I. Show Description
Egg-laying (Egl) defects and subsequent internal hatching of progeny (Bagging) in > 95% of animals. xe11 is a C-to-U point mutation in each of the endogenous let-7 complementary sites, LCS1 and LCS2 [I:C9,335,211T & I:C9,335,260T]. xe11 is a weak gain-of-function allele: mutation of two functionally relevant let-7 binding sites impairs repression by let-7 causing over-expression of LIN-41 in L4 stage animals. Reference: Ecsedi M, et al. Dev Cell. 2015 Feb 9;32(3):335-44. Do not distribute this strain; other labs should request it directly from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
HW1870 C. elegans lin-41(xe8)/lin-41(bch28[eft-3p::gfp::h2b::tbb-2 3'UTR] xe70) I. Show Description
Pick GFP+, Egl to maintain. Segregates GFP- lin-41(xe8) homozygotes (die by vulval bursting as young adults), lin-41(xe8)/lin-41(bch28[eft-3p::gfp::h2b::tbb-2 3'UTR] xe70) heterozygotes (GFP+, Egl), and lin-41(bch28[eft-3p::gfp::h2b::tbb-2 3'UTR] xe70) (GFP+, Ste, Dpy). lin-41(xe8) is a deletion of let-7 binding sites in the lin-41 3'UTR. The balancer was derived from lin-41(bch28), a lin-41(0) allele in which an expression cassette that drives ubiquitous nuclear GFP from the eft-3 promoter has been inserted into the lin-41 coding sequence (Katic et al., G3 (2015) 5:1649-56). References: Katic et al., G3 (2015) 5:1649-56 for lin-41(bch28) starting allele for balancer generation. Aeschimann F, et al. (2019). A single let-7 target to coordinate transition to adulthood. Life Science Alliance 2, e201900335. for balanced line. Do not distribute this strain; other labs should request it directly from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
JN579 C. elegans peIs579. Show Description
peIs579 [ttx-3p::casp1 + ttx-3p::Venus + lin-44p::GFP]. AIY neurons are ablated by specific expression of caspase. Reference: Kunitomo H, et al., 2013, Nat Commun. 2013;4:2210. doi: 10.1038/ncomms3210.
JT8132 C. elegans lin-49(sa470) IV; him-5(e1490) V. Show Description
Males are abnormal. Variable additional defects: Con, Egl, Unc. Temperature sensitive. See also WBPaper00003938.
JT9461 C. elegans lin-48(sa469) III; him-5(e1490) V. Show Description
Male spicule defect.
JT9819 C. elegans unc-24(e138) lin-49(s1198) unc-22(s7) IV/nT1 [unc-?(n754) let-?] (IV;V). Show Description
Heterozygotes are Unc and segregate Unc, lethal Twitchers and dead eggs. Twitchers arrest in early-mid larval development. See also WBPaper00003938.
KS46 C. elegans lin-44(n1792) I; egl-20(n585) IV. Show Description
MH1914 C. elegans lin-40(ku285) V. Show Description
Animals grow slowly and are semi-sterile. Vulval lineage defective.
MH2211 C. elegans unc-29(e1072); sur-6(ku123); kuIs57. Show Description
kuIs57 [col-10p::lin-45(gf) + sur-5::GFP]. Reference: Yoder JH, et al. EMBO J. 2004 Jan 14;23(1):111-9.
MH575 C. elegans lin-45(ku51) dpy-20(e1282) IV. Show Description
Weak hypomorphic allele of lin-45. Animals are Dpy but otherwise appear normal.
MH620 C. elegans lin-45(ku112) dpy-20(e1282) IV. Show Description
Weak hypomorphic allele of lin-45. Animals are Dpy but otherwise appear normal. Occasional larval lethality.
MT2257 C. elegans lin-42(n1089) II. Show Description
Semi-Dpy, not completely penetrant. L3 molt alae. L2d suppressed.
MT4051 C. elegans lin-44(n1792) I; him-5(e1490) V. Show Description
At 20C about 50% of the hermaphrodites are Egl. Males have an abnormal tail and do not mate.